Locate the "gene" below based on finding a start codon sequence and a stop codon sequence. Once the gene is located, determine the primary sequence of the polypeptide (using the codon map below): 'ATTCAATTGATATCACGTATTCS SAAGTTAAATACTGTGCATAAG'. mRNA Codon Map (Table): C UUU phe UCU ser UUC phe UCC ser UUA leu UCA ser UUG leu UCG ser CUU leu CCU pro CUC leu CCC pro CUA leu CCA pro CUG leu CCG pro AUU ile ACU thr AUC ile ACC thr AUA ile ACA thr AUG met ACG thr GUU val GCU ala GUC val GCC ala GUA val GCA ala GUG val GCG ala UAU tyr UAC tyr UAA stop UAG stop CAU his CAC his CAA gln CAG gln AAU asn AAC asn AAA lys AAG lys UGU cys UGC cys UGA stop UGG trp CGU arg CGC arg CGA arg CGG arg AGU ser AGC ser AGA arg AGG arg GGU gly GGC gly GGA gly GGG gly leu val asn lys lys asn val leu arg phe val met his ser val phe met
Added by Gregory G.
Close
Step 1
We need to locate the gene based on finding a start codon sequence and a stop codon sequence. The start codon is AUG, which codes for methionine (Met), and the stop codons are UAA, UAG, and UGA, which do not code for any amino acid. Show more…
Show all steps
Your feedback will help us improve your experience
Joy Chugh and 68 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Look at the following DNA region that codes for a specific gene: Coding strand: ATGTGCCCGAATGTTCTATAG Template strand: TACACGGGCTTACAAGATATC Write down the sequence of the mRNA that will be transcribed from this sequence: Using the Genetic code table, translate the mRNA into amino acids: How many codons does the mRNA have? How many amino acids does the polypeptide have? In eukaryotes, where do the processes of translation and transcription take place? Second letter: UUU - Phenylalanine UUC - Phenylalanine UUA - Leucine UUG - Leucine UCU - Serine UCC - Serine UCA - Serine UCG - Serine UAU - Tyrosine UAC - Tyrosine UGU - Cysteine UGC - Cysteine UAA - Stop codon UGA - Stop codon UAG - Stop codon UGG - Tryptophan CUU - Leucine CUC - Leucine CUA - Leucine CUG - Leucine CCU - Proline CCC - Proline CCA - Proline CCG - Proline CAU - Histidine CAC - Histidine CGU - Arginine CGC - Arginine CGA - Arginine CGG - Arginine CAA - Glutamine CAG - Glutamine AUU - Isoleucine AAU - Asparagine AGU - Serine ACU - Threonine AAC - Asparagine AGC - Serine AUC - Isoleucine ACC - Threonine AUA - Isoleucine ACG - Threonine AGA - Arginine AUG - Methionine ACG - Threonine AAG - Lysine AGG - Arginine GUU - Valine GCU - Alanine GAU - Aspartic acid GGU - Glycine GUC - Valine GCC - Alanine GAC - Aspartic acid GGC - Glycine GUA - Valine GCA - Alanine GAA - Glutamic acid GGA - Glycine GCG - Glutamic acid GUG - Valine GAG - Glutamic acid GGG - Glycine
Adi S.
(Ch17) Codon Chart: What amino acid sequence will be generated from the following mRNA sequence? 5' AUGGAUCGUUUAUCCUUG 3' UUU = phe UCU = ser UAU = tyr UGU = cys UUC = phe UCC = ser UAC = tyr UGC = cys UUA = leu UCA = ser UAA = stop UGA = stop UUG = leu UCG = ser UAG = stop UGG = trp CUU = leu CCU = pro CAU = his CGU = arg CUC = leu CCC = pro CAC = his CGC = arg CUA = leu CCA = pro CAA = gln CGA = arg CUG = leu CCG = pro CAG = gln CGG = arg AUU = ile ACU = thr AAU = asn AGU = ser AUC = ile ACC = thr AAC = asn AGC = ser AUA = ile ACA = thr AAA = lys AGA = arg AUG = met ACG = thr AAG = lys AGG = arg GUU = val GCU = ala GAU = asp GGU = gly GUC = val GCC = ala GAC = asp GGC = gly GUA = val GCA = ala GAA = glu GGA = gly GUG = val GCG = ala GAG = glu GGG = gly Met-Leu-Phe-Arg-Glu-Glu Met-Arg-Glu-Arg-Glu-Phe Met-Asp-Leu-Ser-Leu-Arg Met-Asp-Arg-Leu-Glu-Arg Met-Asp-Arg-Leu-Ser-Leu
Joanna Q.
Which of the following three genes codes for the protein below? You will need to 1) create the mRNA, 2) remove the portion of the gene that does not code for proteins 3) find the start codon 4) Group the bases into their triplet codon and 5) and use the codon chart to help translate into amino acids. The letters in blue are the exons and the letters in black are the introns. Protein: GREAT GENE 1: TCACCGTACCCGGTACGAGGCCACCACTGTGTCCTATGTACTTATTCGGCA GENE 2: TCACCGTACCCGGTACAGCGCCACTGTGTTCGTTGTACTCATTCGGCA GENE 3: TCACCGTACCCGGTACACGCCACTGTGTTCGTTGTACTCATTCGGCA
Sri K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Watch the video solution with this free unlock.
EMAIL
PASSWORD