Part A DNA replication occurs by adding ______. (Note: NTPs = nucleotide triphosphates; dNTPs = deoxynucleotide triphosphates) dNTPs to the 3' end of the daughter strand dNTPs to the 3' end of the template strand NTPs to the 5' end of the daughter strand dNTPs to the 5' end of the template strand NTPs to the 3' end of the daughter strand Submit Request Answer
Added by Ana J.
Close
Step 1
** Show more…
Show all steps
Your feedback will help us improve your experience
Jenny Wu and 70 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If the sequence within a parent DNA template strand is 5'-ATAGGTC-3', then the sequence of its daughter strand would be __________.
Brooke S.
Use your knowledge of DNA replication to produce the complementary daughter strand for the sequence given below. Be sure to label the 5' and 3' ends and indicate in which direction replication would occur (use an arrow). 5' – ATCGGCCTAGACCTTATCGGCTC – 3'
Supreeta N.
Dna replication occurs by the addition of nucleotides to the end of the dna molecule. results in the formation of four new dna strands. produces two daughter dna molecules that are complementary to each other. uses each strand of a dna molecule as a template for the creation of a new strand. begins when two dna molecules join together to exchange segments.
Mystique T.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD