Question

Procedure 1: Using scoring matrix for DNA sequence alignment Calculate the score for the DNA sequence alignment shown below, using the following scoring matrix. A T G C A 2 -1 1 -1 T -1 2 -1 1 G 1 -1 2 -1 C -1 1 -1 2 1. Use an affine gap penalty to score the gaps, with -5 for opening the gap and -1 for each position in the gap. 2. How would the score change if a non-affine penalty was used instead, -5 for all gaps? GACTACGATCCGTATACGCACA ------ GGTT CAGAC GACTACAGCGCGTATACGCACACATGGTTCAGAC

          Procedure 1: Using scoring matrix for DNA sequence alignment
Calculate the score for the DNA sequence alignment shown below, using the following
scoring matrix.
A	T	G	C
A	2	-1	1	-1
T	-1	2	-1	1
G	1	-1	2	-1
C	-1	1	-1	2
1. Use an affine gap penalty to score the gaps, with -5 for opening the gap and -1 for
each position in the gap.
2. How would the score change if a non-affine penalty was used instead, -5 for all gaps?
GACTACGATCCGTATACGCACA
------
GGTT CAGAC
GACTACAGCGCGTATACGCACACATGGTTCAGAC

Show more…

Procedure 1: Using scoring matrix for DNA sequence alignment
Calculate the score for the DNA sequence alignment shown below, using the following
scoring matrix.
A T G C
A 2 -1 1 -1
T -1 2 -1 1
G 1 -1 2 -1
C -1 1 -1 2
1. Use an affine gap penalty to score the gaps, with -5 for opening the gap and -1 for
each position in the gap.
2. How would the score change if a non-affine penalty was used instead, -5 for all gaps?
GACTACGATCCGTATACGCACA
——
GGTT CAGAC
GACTACAGCGCGTATACGCACACATGGTTCAGAC

Added by Vickie R.

Biology for AP Courses

Julianne Zedalis, John Eggebrecht

Instant Answer

Solved by Expert Arun Bana

Step 1

First, let's create a table to keep track of the scores for each position in the alignment. We will also create a table to keep track of the traceback information. Alignment Table: A T G C A T A C G A T C C G T A 0 -5 -10 -15 -20 -25 -30 Show more…

Show all steps

lock

Thanks for your feedback!

Procedure 1: Using scoring matrix for DNA sequence alignment Calculate the score for the DNA sequence alignment shown below, using the following scoring matrix: A T G C A 2 -1 1 -1 T -1 2 -1 1 G 1 -1 2 -1 C -1 1 -1 2 1. Use an affine gap penalty to score the gaps, with -5 for opening the gap and -1 for each position in the gap. 2. How would the score change if a non-affine penalty was used instead, -5 for all gaps? GACTACGATCCGTA A A A - T A C GACTACAGCGCGTATA ACATGG A

Play audio

Feedback

Powered by NumerAI

Arun Bana and 98 other subject Biology educators are ready to help you.

Ask a new question

Labs

Want to see this concept in action?

NEW

Explore this concept interactively to see how it behaves as you change inputs.

View Labs

Key Concepts

Recommended Videos

Recommended Textbooks

Ace is your personal tutor. It breaks down any question with clear steps so you can learn.

Start Using Ace

Continue solving this problem

Create a free account to:

View full step-by-step solution
Ask follow-up questions with Ace AI
Save progress and study later