Question 10 How many amino acids will be needed to build the protein coded by the transcript: GUCGCGAAUGAACGCCAUCUGAGATC? Select one: a. 5 b. 4 c. 3 d. 12
Added by Thomas J.
Close
Step 1
Step 1: Write the RNA sequence: GUCGCGAAUGAACGCCAUCUGAGAUC Show more…
Show all steps
Your feedback will help us improve your experience
Marlyn Joyce and 78 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
How many amino acids can be coded for by 1500 nucleotides in an mRNA molecule?
Anand J.
Madhur L.
Most proteins contain more than 100 amino acid residues. If you decided to synthesize a " 100 -mer," with 20 different amino acids available for each position, how many different molecules could you make?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD