Question 17 Read the extract below. Long before the development of agricultural crops, South African villagers would pick the sweetest and largest fruits of the marula tree and scatter them around their camps. The seeds of these fruit would germinate and grow into fruit-bearing trees. The best fruit would then be chosen from these trees and the process would be repeated. In recent times, farmers use a process called marcotting. This invoives peeling away the bark in one area around a branch. This area is stimulated to form roots. The branch is then removed from the tree and planted in the soil to produce more marula trees. 17.1 Name the characteristics that the villagers were selecting. 17.2 Explain how this practice is an example of artificial selection. 17.3 Give ONE environmental factor that couid affect the characteristics named in QUESTION 17.3. 17.4 Explain ONE disadvantage of a plantation of marula trees grown through marcotting compared to a population of marula trees that have reproduced naturally. 17.5 Explain whether the fruits from marcotted maruia trees could be classified as genetically modified (GM). 17.6 State TWO benefits of genetic modification. Question 18 Differentiate between a population and a species, describe speciation by geographic isolation and explain how speciation and extinction affect biodiversity. Content: (17) Synthesis: \( \quad(3) \) (20)
Added by Jeremiah E.
Close
Step 1
- The villagers were selecting the sweetest and largest fruits of the marula tree. Show more…
Show all steps
Your feedback will help us improve your experience
Rudra Singh and 76 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
1a and b?
Supreeta N.
The Cavendish banana is the most popular fruit in the world, but is currently threatened by extinction due to a fungal agent (see the photo). This banana variety is "triploid" (3 $n$, with three sets of chromosomes) and can only reproduce through cloning by cultivators. Given what you know about meiosis, explain how the banana's triploid number accounts for its seedless condition. Considering genetic diversity, discuss how the absence of sexual reproduction might contribute to the vulnerability of this domesticated species to infectious agents.
Sri K.
QUESTIONS Question 4-1: You want to sequence a 5-kb gene in (a) one person; (b) 1000 people. What technologies would you choose and why? How would this change if the region was 5 Mb in size? Question 4-2: You want to type a single SNP in (a) one person; (b) 100 people; (c) 10,000 people. What technologies would you choose and why? How would this change if the number of SNPs was 10, or 10 million? Question 4-3: Consider the following four primer pairs (each written 5' to 3'), and use BLAST and any other appropriate online tools to explain the PCR results described, using human genomic DNA as template. Primers (a) CTAAAGATCAGAGTATCTCCCTTTG AAATTGTTTTCAATTTACCAG Result: 379-bp single band, though only in half of the individuals you test (b) CTAAAGATCAGAGTATCTCCCTTTG CTGGTAAATTGAAAACAATTT Result: no product (c) TGCTTGAAGCTACGAGTTTG ATACATGCAGATACTCAGAG Result: a smear of products of diverse sizes (d) ACTAGCTCAAGTATAGAGTG AAATTGTTTTCAATTTACCAG Result: no product REFERENCES
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD