Question 2 miRNA targets a complementary mRNA molecule for.... synthesis protection proliferation enhancement dstruction 1 pts
Added by Suzanne B.
Close
Step 1
Step 1: Identify what miRNA is — microRNAs are ~20–24 nucleotide noncoding RNAs that regulate gene expression after transcription. Show more…
Show all steps
Your feedback will help us improve your experience
Derrick Danso and 54 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
What appears to be the specific role of the antisense siRNA strand in destruction of its target mRNA? A. It activates drosha. B. It stabilizes the target mRNA. C. It disassembles the RISC complex D. It guides the pre-RISC complex to the target mRNA due to its complementary sequence. E. It cleaves the target mRNA.
Derrick D.
Question 12 If you expose a cell to chemicals that specifically disrupt the function of RNA polymerase, which of the following processes will be most directly affected? transcription translation DNA replication rate of mutation Question 13 In a ribosome in the process of translating a molecule of mRNA, the maximum number of codons that can be occupied by a tRNA at any one time is 1. 2. 3. 64. Question 14 Similar to genes that code for proteins, the products of genes that code for rRNA and tRNA must also undergo translation. transcription. replication. mutation.
Josee P.
Question 5: Compare the two mRNAs. Does the second sequence differ from the mRNA 1 sequence? mRNA 1: 5' - GACACCAUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACU - 3' mRNA 6: 5' - GACACCAUGGUGACCCACCUGACUCCUGAGGAGAAGUCUGCCGUU - 3' There is no difference between the two mRNA sequences. There is a missense mutation. There is a deletion of a codon that produces a frameshift mutation. There is an insertion that produces a frameshift mutation. There is a nonsense mutation. There is a deletion that produces a frameshift mutation.
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Watch the video solution with this free unlock.
EMAIL
PASSWORD