For the following mRNA sequence write the amino acid sequence that would result from these mRNA codons (use three letter codes for amino acids). Assume transcription and translation occur from left to right and don't forget that translation starts with the amino acid met and ends at a stop codon. Include the word STOP in the amino acid sequence to represent the stop codon. mRNA CAAUGAGCUGGGGGUAUUACUUUUAGUAG AA
Added by Kyle B.
Close
Step 1
Step 1:** Identify the mRNA codons and their corresponding amino acids: - UUU: Phe - UCU: Ser - UUC: Phe - UCC: Ser - UUA: Leu - UCA: Ser - UUG: Leu - CUG: Leu - CUU: Leu - CCU: Pro - CUC: Leu - CUA: Leu - CCA: Pro - CUG: Leu - CCG: Pro - AUU: Ile - ACU: Thr - Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 80 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
For the following mRNA sequence write the tRNA anti-codon sequence that would pair with these mRNA codons. Assume transcription and translation occur from left to right and don't forget that translation starts with the amino acid met and ends at the stop codon. mRNA CAAUGAGCUGGGGGUAUUACUUUUAGUAG tRNA
Shaiju T.
Given the mRNA strand sequence: AUG CCU AGU GCU. Using the table below, what is the sequence of amino acids created from the mRNA sequence above? Met, Pro, His, Tyr Met, Ser, Gln, Ala Met, Pro, Pro, Thr Met, Pro, Ser, Ala
Maitreya E.
The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: $\quad$ GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU, UUC Asp: GAU, GAC These sequences are complementary to the sequences in DNA. a. Give the corresponding sequences in DNA for the amino acids listed above. b. Give a DNA sequence that would code for the peptide trp-glu-phe-met. c. How many different DNA sequences can code for the tetrapeptide in part b? d. What is the peptide that is produced from the DNA sequence T-A-C-C-T-G-A-A-G? e. What other DNA sequences would yield the same tripeptide as in part d?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD