Question 33 1 pts EcoRI cuts a DNA sequence at 4 different sites. How many fragments of DNA would be generated? 2 5 3 4 Question 34 1 pts What does RFLP stand for? restriction for long pieces recognition fragment length pieces restriction fragment length polymorphism required fragment length polymorphism
Added by Joan D.
Close
Step 1
Question 33: Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If a circular piece of DNA has three sites for a particular restriction enzyme, into how many fragments will that restriction enzyme cut the DNA? 4 2 3 5 None of the above
Madhur L.
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between G and A. 1. How many fragments you will get 2. Specify the size (Number of bases) and write the nucleotides sequences of each fragment, pay attention to DNA direction (5'-3') 5' CCGGGAGATCTC CGGGCTAGGCAT TAA GCAATTGGAACAGAATTCGGGCCCGATCCGTA 3'
Adi S.
The restriction endonuclease BamH1 has the recognition sequence G/GATCC and Sau3A the recognition sequence /GATC. Genomic DNA (G/C content = 56%) is digested with Sau3A and ligated into a vector digested with BamH1. What percentage of fragments could potentially be ligated into the vector and what is the average fragment length of the insert DNA?
Supreeta N.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD