Refer to the codon table as necessary to answer the questions. Consider the template DNA sequence 3'-ATTAGC-5'. Give the sequence of the dipeptide formed after transcription and translation using the three-letter designations for the amino acids. dipeptide sequence: Stop codon-Serine Codons Second Position U C A G U UUU Phenylalanine UCU Serine UAU Tyrosine UGU Cysteine U UUC Phenylalanine UCC Serine UAC Tyrosine UGC Cysteine C UUA Leucine UCA Serine UAA Stop UGA Stop A UUG Leucine UCG Serine UAG Stop UGG Tryptophan G C CUU Leucine CCU Proline CAU Histidine CGU Arginine U CUC Leucine CCC Proline CAC Histidine CGC Arginine C CUA Leucine CCA Proline CAA Glutamine CGA Arginine A CUG Leucine CCG Proline CAG Glutamine CGG Arginine G A AUU Isoleucine ACU Threonine AAU Asparagine AGU Serine U AUC Isoleucine ACC Threonine AAC Asparagine AGC Serine C AUA Isoleucine ACA Threonine AAA Lysine AGA Arginine A AUG Methionine ACG Threonine AAG Lysine AGG Arginine G G GUU Valine GCU Alanine GAU Aspartic acid GGU Glycine U GUC Valine GCC Alanine GAC Aspartic acid GGC Glycine C GUA Valine GCA Alanine GAA Glutamic acid GGA Glycine A GUG Valine GCG Alanine GAG Glutamic acid GGG Glycine G Third Position
Added by Sean S.
Close
Step 1
Step 1: Transcribe the DNA sequence to mRNA. Show moreā¦
Show all steps
Your feedback will help us improve your experience
Jackson Miner and 54 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Use the DNA sequence and the codon table below to answer the next two questions. (3 pts) DNA: GAGCCTACCACTATCCTACTA 1. mRNA: (type letters without spaces) 2. Mini-polypeptide: (type amino acid and - ; for example AA1-AA2-AA3...)
Joanna Q.
3' - TACAATCTCGGTATGATT - 5' Transcribe the above DNA into mRNA below. Translate the above mRNA into amino acid sequence below.
Madhur L.
The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU, UUC Asp: GAU, GAC These sequences are complementary to the sequences in DNA. a. Give the corresponding sequences in DNA for the amino acids listed above. b. Give a DNA sequence that would code for the peptide trp-glu-phe-met. c. How many different DNA sequences can code for the peptide in part b? d. What is the peptide that is produced from the DNA sequence T-A-C-C-T-G-A-A-G? e. What other DNA sequences would yield the same tripeptide as in part d?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD