RNA; DNA DNA; amino acids RNA; proteins DNA; RNA
Added by Stephanie W.
Close
Step 1
Step 1: DNA is the blueprint of life, containing the genetic instructions for building and maintaining an organism. Show more…
Show all steps
Your feedback will help us improve your experience
Anna D. and 93 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Anna D.
Anand J.
31. Both DNA and RNA: (a) are single stranded molecules (b) contain the same four nucleotide bases (c) are types of amino acids (d) have the same five carbon sugar (e) contain phosphate groups. 32. Which of the following is found in RNA but not in DNA? (a) adenine (b) cytosine (c) guanine (d) uracil (e) phosphate groups 33. All of the following are directly involved in the making of proteins except: (a) mRNA (b) small subunit of the ribosome (c) tRNA (d) amino acids (e) RNA polymerase. 34. If a tRNA molecule specialized for the transfer of the amino acid valine has the anticodon CAG, with what codon on mRNA will it couple? (a) CAG (b) GAC (c) GTC (d) TUG (e) GUC 35. If a bacterial protein has 30 amino acids, how many nitrogen bases would be needed to code for it? (a) 10 (b) 30 (c) 60 (d) 90 (e) 120. 36. A region along the DNA molecule that contains the instructions for making a particular protein is called a __________. (a) nucleotide (b) anticodon (c) codon (d) gene (e) promoter. 37. Which of the following changes in DNA would you expect to have the greatest effect on the protein it codes for? 1 2 3 Start End ------> ATCGAGCGGCTGATCATTAGT (a) substitution of base at 1 (b) deletion of base at 1 (c) deletion of base at 2 (d) addition of base at 3 (e) substitution of base at 3
Bryan V.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD