Review The nucleosome "bead" is an octomer of histone proteins. Indicate which specific histone proteins are part of each tetramer within the octomer, and which histone protein fastens the DNA to the "bead." Drag the correct labels onto the diagram. View Available Hint(s) Reset Help Histone Octamer tetramer tetramer dimer H2A dimer H3 dimer dimer dimer dimer H1 H2A H2B H3 H4 Histone "fastener"
Added by Michele S.
Close
Step 1
A nucleosome is composed of an octamer of histone proteins, which means there are eight histone proteins in total. These eight proteins are organized into two tetramers and two dimers. The two tetramers are each composed of two copies of histone H3 and two copies Show more…
Show all steps
Your feedback will help us improve your experience
Jenny Wu and 73 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
PART 3: ELONGATION OF REPLICATION Label the ends of the DNA strands. Label the leading and lagging strands of the DNA. Fill in what you would expect in snapshot #4. In your diagram, include the enzyme: ligase. Model 2 DNA replication begins at a single location on the chromosome. This forms a replication bubble. This replication bubble can be split down the middle into two replication forks. One fork is shown in detail below: Snapshot #1 Snapshot #2 Snapshot #3 Snapshot #4
Sri K.
Molecular Composition - The Composition of DNA Two DNA strands (called) Figure 25 hold in DNA bases; operate IA-1 Name the bonds that connect DNA strands and the three-dimensional shape of the DNA molecule: double helix How many base pairs Different this segment of DNA model: What is Finalizing 01S-pairing
Adi S.
3. The following DNA sequence is found upstream of a gene. Identify each of the following components: TTGACCCGGTTCCAATATCGGCATTTGACAACGTATGCAGGCCTATAATCATGGACCGAGATCA a) Identify the promoter by circling the consensus sequences. b) What is the complementary DNA sequence. Write out the entire sequence. c) Label the 5′ and 3′ ends of both sequences. d) Identify the coding and template strands. e) Draw an arrow to where mRNA synthesis likely begin and label the TSS. f) Write out the mRNA sequence.
Dennis H.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD