SEQUENCING INFORMATION One reading skill is the ability to sequence information, or to logically place items or events in the order in which they occur. Sequence the statements below to show the steps of the disease asbestosis. Write "1" on the line in front of the first step, "2" on the line in front of the second step, and so on. 7. Asbestos fibers are inhaled. 8. A person is exposed to asbestos in the air. 9. The person has an increasingly difficult time breathing. 10. Inhaled fibers cut and scar the person's lungs. 11. The person may die of heart failure. 12. The disease asbestosis develops.
Added by Shawn H.
Close
Step 1
Step 1: A person is exposed to asbestos in the air. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 82 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
EXERCISE 1: An Exercise in Manual Contig Sequence Assembly DNA sequence assembly has been practiced since the old days of Sanger dideoxy sequencing and until the present method of assembling thousands of fragments, or contigs, generated by massively parallel Next-generation sequencers (NGS). In bioinformatics, sequence assembly refers to the alignment based on sequence similarity of overlapping DNA fragments in order to assemble the complete sequence. This is essential as current DNA sequencing technology cannot read whole genomes in one 'read.' There exist many programs to accomplish this, and we shall deal with those later in this course. The current exercise is a 'de novo' sequence assembly of a few sequences using your mind's pattern recognition abilities (think of this as a puzzle game). Modern large assemblies utilize a reference published genome. Computers use a 'greedy algorithm' by calculating the pairwise alignments between fragments of sequences, then determining the consensus sequence of the most closely related sequences to form contigs. Merge contigs with the highest homology or overlap into a larger single consensus sequence. As an example below: Seq 1: 5' - GGTAA - 3' Seq 2: 5' - CGGTA - 3' Seq 3: 5' - TTACG - 3' Seq 4: 5' - CCTTA - 3' Step 1: Make a DNA Sequence Similarity Matrix in Percentage. Seq 1 Seq 2 Seq 3 Seq 4 Seq 1 80% 20% 0% Seq 2 40% 0% Seq 3 60% Seq 4 Step 3: Find consensus sequence of the most similar, overlapping sequence: Seq 1: 5' - GGTAA - 3' Seq 2: 5' - CGGTA - 3' Consensus A: 5' - CGGTAA - 3' Seq 3: 5' - TTACG - 3' Seq 4: 5' - CCTTA - 3' Consensus B: 5' - CCTTACG - 3' Step 3: Merge the two contigs to determine the Complete Sequence Consensus. Consensus A: 5' - CGGTAA - 3' Consensus B: 5' - CCTTACG - 3' Complete sequence: 5' - CCTTACGGTAA - 3' Below is a series of short sequences generated by sequencers. To test your critical thinking skills, I intentionally added a sequence that does not belong below. Objective: Manually align and assemble the two types of sequences: the H (Heavy) strand and L (Light strand) into a single contiguous complete sequence. Identify the sequence that does not belong. Seq 1: H STRAND 5' - CCATTTCGGATCGATTCGA - 3' Seq 2: H STRAND 5' - CGATTCGATTTTAACACGTA - 3' Seq 3: H STRAND 3' - ATGCACAATT - 5' Seq 4: H STRAND 3' - CCACCGGACATCAA - 5' Seq 5: L STRAND 5' - CGAAATGGTTTT - 3'
Sri K.
DNA Sequencing DNA sequencing techniques can determine the actual order or sequence of the bases in a segment of DNA. This is helpful in diagnostic situations and is a much more accurate test compared to electrophoresis. If the ‐normal" sequence of a gene is known, sequences from patients can be compared to determine if there are variants. The techniques are complicated, but interpretation of the results is not. In Figure 4 you see an example of the results from a sequencing reaction. On the left are the bands that are generated from the sequencing procedure. At each position in the DNA sequence, one of the four bases fluoresce. The sequence would be read from the bottom: ATGAGCGACCGAG. Figure 4 Sample sequencing results The actual pictures from a sequencing reaction look like an X-ray and are called "autoradiographs". In the autoradiograph on the left, the columns left to right are GATC. The sequence is read from the bottom, with each black "blip" representing one nucleotide. Valerie is concerned about her children, even though they are all healthy and show no signs of cancer at this time. She wondered if any of her children had a variant in the BRCA1 gene. Valerie requested that DNA sequencing be done on her DNA to determine if she had a variant in the BRCA1 gene, and to see if the sequencing results agreed with the electrophoresis results. 15. It was found that the sequence of bases in the coding region of Valerie's BRCA1 gene was changed. Does this suggest and/or support that Valerie has hereditary breast cancer? Explain.
Farhan A.
Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to transcribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment, the middle fragment, and the end fragment. Procedure 1. Copy each of the following sequences onto a separate piece of paper. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT Sequence B TCAGACGTTTTTGCCCCGTAACAACTTGTTACAA CATGGTCATAAACGTCAGAGATGGTCAATCTCTTAAT GACT Sequence C TACAAACATGTAAACACACCCTCAGTGGACCAACTC CGCAACATAAACCAAACACCGCTCGCGCCGAAAAA GATATGG 2. Divide the sequences into triplets (codons) by putting a slash between each group of three bases. 3. Transcribe the DNA into mRNA. 4. Identify the middle, end, and beginning sequence. Use your knowledge of start and stop codons to help you figure it out. 5. Remove codons 24 to 66, including codon 66. 6. Translate the mRNA into protein using the genetic code. Analysis (a) Which fragment was the beginning fragment? How do you know? (b) Which fragment was the end fragment? How do you know? (c) Codons 24 to 66 represent an intron. At what point in the process of protein synthesis are introns removed? What is the name of the enzyme responsible for this excision? (d) How many amino acids does this protein contain? (e) Is this genetic sequence eukaryotic or prokaryotic? How do you know? (f) If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not? (g) Provide the anticodon sequence that would build this protein.
Katlin K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD