Shown below is the DNA sequence of a gene from a virus that encodes a short viral peptide. Also shown is the sequence of the mRNA synthesized from this gene. Genomic DNA sequence: 5'-AGCTCATGTGCGAGTCCTGACGCTGACTAGG-3' 3'-TCGAGTACACGCTCAGGACTGCGACTGATCC-5' Mature mRNA sequence (G* = 5’ G cap): 5'-G*UCAUGUGCGAACGCUGACUAGGAAAAAAAA....-3' 1) In the genomic DNA sequence shown above, draw a box around each of the two exons in the gene. 2) In the mRNA above, some nucleotides are present that are not coded for in the genomic DNA sequence. Name the two processes that have occurred to add these nucleotides to the mRNA. 3) Circle the start and stop codon in the mRNA. How many amino acids are in the viral peptide encoded by this gene? 4) Is this virus more likely to replicate in prokaryotic or eukaryotic cells? Briefly explain your reasoning.
Added by Mohamed G.
Step 1
The exons are as follows: 5'-AGCTCA**TGTGCGAGTCCTGACGCTGACTAGG**-3' 3'-TCGAGT**ACACGCTCAGGACTGCGACTGATCC**-5' The two exons are enclosed within the double asterisks. 2) The two processes that have occurred to add the extra nucleotides to the mRNA are: - 5' Show more…
Show all steps
Close
Your feedback will help us improve your experience
Madhur L and 91 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
A portion of the template strand of a gene is provided below: 5 ' - ATGACAAACGAT - 3 ' Answer the following questions about this DNA template. a. Provide the sequence of the portion of the mRNA that would be produced upon transcription of this DNA template. Provide single-letter nucleotide code in the 5' to 3' direction (do not use spaces or extra characters). 5'UACUGUUUGCU b. Assuming that translation begins starting from the first nucleotide, what amino acid sequence would be encoded by the portion of the mRNA transcribed in part (a)? Provide the single-letter amino acid code starting from the amino (N) terminus and proceeding toward the carboxyl (C) terminus (do not use spaces or extra characters). (N)YCLL c. What is the anticodon sequence from the tRNA that decodes the first codon in the portion of the mRNA that was transcribed in part (a)? Provide the anticodon sequence that forms three canonical (Watson-Crick) base pairs with the codon using single-letter nucleotide code in the 5' to 3' direction (do not use spaces or extra characters). 5'ACA3'
Sri K.
The diagram below (Figure 3) shows a schematic illustration of Gene V, which contains two exons. The location of Gene V's start and stop codons are indicated. A portion of the gene is blown up to show the genomic DNA sequence along with the corresponding segment of mature mRNA. A splice site is underlined in the genomic DNA sequence. 4.1 Which strand (top or bottom) is the template strand? Which strand is the coding strand? 4.2 Is the promoter to the left or right in the diagram above? Does transcription go from right to left or from left to right on this gene? 4.3 Is the underlined splice site a splice donor site, branch site, or splice acceptor site? How do you know? 4.4 Indicate the correct reading frame of the mature mRNA. (Hint: The stop codon for gene V is indicated in the diagram). 4.5 Write the peptide segment coded for by the mature mRNA sequence shown above with N-terminus and C-terminus indicated.
Madhur L.
1. The non-template strand of a gene contains a sequence that reads 5' CGCGGACTT 3'. What is the resulting mRNA sequence transcribed from the template strand? Using the codon table, list the sequence of amino acids that would result from this mRNA strand. A base substitution mutation changes the third G in this non-template strand to an A. The template strand base pairs correctly with the substituted A. What change would happen to the amino acid sequence? What type of mutation does this result in? Predict how well the protein synthesized would function after this mutation. 2. The development of DNA technology is bringing profound changes to science, agriculture and healthcare. Provide two examples of DNA technology by briefly explaining the process. Also, provide at least one benefit and one example of a concern or problem associated with the use of each. 3. Compare and contrast the stages (attachment, entry or penetration, uncoating, biosynthesis, and release) of viral multiplication between bacteriophages and animal viruses.
Jackson M.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD
