The coding sequence of DNA is 5’–CCGATT–3’ . What is the noncoding sequence?
Added by Chastity C.
Step 1
In this case, the coding sequence is 5’–CCGATT–3’. Show more…
Show all steps
Your feedback will help us improve your experience
Kaela Piechowicz and 101 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
A gene begins with the following coding sequence: 5’ ATCCTCCGCAATACG. What is the correct sequence of its mRNA?
Joanna Q.
What is the DNA sequence for the molecule shown here?
The sequence of part of an mRNA transcript is: 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' What is the sequence of the DNA coding strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' - ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD