2. The DNA below shows the sequence of a template strand on top (with the ends labeled) and a sequencing primer on the bottom (with the ends not labeled, but shown correctly aligned with the template). 5' - AGTCGGATGTTGTACTGCATGGTACAATAGCATAAGCTGGAGTTTCTTATTCGATGCG - 3' CCATGTTATCGTATTCGA Assume that you have run a set of conventional Sanger dideoxy sequencing reactions using this combination of template and primer. You then run a denaturing polyacrylamide gel to analyze the four sequencing reactions and determine the sequence. Using the DNA sequences shown above, draw the sequencing gel results as you would expect it to appear at the end of electrophoresis. G A T C
Added by Andrea S.
Close
Step 1
The primer will bind to the template strand and DNA polymerase will start synthesizing the complementary strand. Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 62 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Sanger sequencing is done with labeled dideoxynucleotides. These are nucleotides that do not contain the 3' -OH on the ribose. The effect of including these in a PCR reaction is that they cause termination of the reaction before the end of the template is reached. Below is a representation of the results you would get from running a Sanger sequencing reaction on an acrylamide gel. This type of gel has single nucleotide resolutions so you can differentiate fragments of DNA that differ by a single nucleotide. Each of the lanes contain a different Sanger reaction. The lane labeled A contains a Sanger reaction where dideoxyadenosine was added. For this lane, the bands you see will show you where in the sequence you would find an adenine. The lane labeled "T" had dideoxythymidine and thus shows you where the sequence had a thymine. Lane "C" shows you cytosine and lane G shows you guanine. The 5' end of the sequence is at the bottom so it should be read 5'-GTAC... Start at the 5' end and record the 20 base pairs DNA sequence displayed on this gel.
Farhan A.
Suppose that you want to sequence the following two DNA fragments: (1) 5'-CGGTACGGATCATC-primer site-3' (2) 3'-primer site -TCAGAGTTCACAAA-5' In each case you first use PCR to amplify the fragment, so that there is sufficient DNA for sequencing. You carry out Sanger dideoxy sequencing with a primer that anneals to the primer site, and then separate the products of the four sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the sequencing reactions for fragments (1) and (2) respectively. (1) Reaction containing ddATP ddCTP ddGTP ddTTP (2) Reaction containing ddATP ddCTP ddGTP ddTTP
Jenny W.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD