The DNA sequence of the template strand for a particular gene is shown below (broken up by codon): 5'-TCC-GAA-GCA-AGT-3'. What is the amino acid sequence specified by this strand of DNA? (Make sure to consider directionality) Second letter U C A G U UUU } Phe UUC UUA } Leu UUG UCU } UCC } Ser UCA UCG UAU } Tyr UAC UAA Stop UAG Stop UGU } Cys UGC UGA Stop UGG Trp U C A G C CUU } CUC } Leu CUA CUG CCU } CCC } Pro CCA CCG CAU } His CAC CAA } Gln CAG CGU } CGC } Arg CGA CGG U C A G A AUU } AUC } Ile AUA AUG Met ACU } ACC } Thr ACA ACG AAU } Asn AAC AAA } Lys AAG AGU } Ser AGC AGA } Arg AGG U C A G G GUU } GUC } Val GUA GUG GCU } GCC } Ala GCA GCG GAU } Asp GAC GAA } Glu GAG GGU } GGC } Gly GGA GGG U C A G First letter Third letter
Added by Donald A.
Close
Your feedback will help us improve your experience
Bryan Valdivia and 85 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following is the template strand of the DNA molecule. Please show the sense strand of DNA, the mRNA, the tRNA, and the sequence of amino acids in the small peptide made. TEMPLATE: 3' – AATACGGAGTTTTTAGCGTAACTAAA – 5' Where do you find the codons? Where are the anticodons?
Adi S.
Below is a template strand of DNA that contains a translation start codon. 5’ – CTTTACGGGATGGCATTG – 3’ a) Assuming this entire sequence is transcribed, write the sequence of the resulting mRNA transcript including appropriate end labels. b) Write the sequence of the polypeptide resulting from this transcript,
Mj A.
The template strand of DNA has the following sequence: TACTTCAAACCGATT A mutation occurred that produced a strand with the following sequence: TAC TTC AAA GCC GAT T
Bryan V.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD