the following is as segment of mrna 5 ucggaaugugguggcauacaggcuuacagaacuaagucugagaau 3 a how many

Name: the following is as segment of mrna 5 ucggaaugugguggcauacaggcuuacagaacuaagucugagaau 3 a how many amino acids long will be the protein translated from the only reading frame available in this 26714
Uploaded: 2023-09-11T09:06:43-08:00
Duration: 2 min 9 s
Channel: Adi S
Description: the following is as segment of mrna 5 ucggaaugugguggcauacaggcuuacagaacuaagucugagaau 3 a how many amino acids long will be the protein translated from the only reading frame available in this 26714

Question

Krishna G · Accepted Answer

First, we need to find the start codon (AUG) in the mRNA sequence. We can see that it starts at

Question

Please give Ace some feedback