The following is the DNA sequence of the wild type allele of Gene Z that you want to amplify using polymerase chain reaction (PCR). 5'CTCGAGGTGAATATGAAAG----GENE Z----CATTTGGCGCGTAATCGATA3' 3'GAGCTCCACTTATACTTTC----GENE Z----GTAAACCGCGCATTAGCTAT5' Choose a pair of primers that would amplify gene Z. Left primer [Select] Right primer [Select]
Added by Rafael P.
Close
Step 1
In this case, we want to amplify the entire Gene Z sequence. Show more…
Show all steps
Your feedback will help us improve your experience
Josee Pacheco and 62 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Josee P.
Question 3 (8 points): The following is the DNA sequence of the wild type allele of Gene Z that you want to amplify using the polymerase chain reaction (PCR). 5' CTCGAGGTGAATATGAAAG --- Gene Z --- CATTTGGCGCGTAATCGATA 3' 3' GAGCTCCACTTATACTTTC --- Gene Z --- GTAAACCGCGCATTAGCTAT 5' a) If you amplify a DNA sequence through PCR what are the reaction components that you would absolutely need? Briefly state the function of each of these components. 3 points b) Circle the set of primers from the options below, which you would use for PCR reaction in part (a)? 1/2 pt. Set 1: 5' TACACTTATACTTTC 3' and 3' GTAAACCGCGCATTAG 5' Set 2: 5' CTCGAGGTGAATAT 3' and 3' CCGCGCATTAGCTAT 5' Set 3: 5' GAGTTACACTTATAC 3' and 3' TGGCGAGTAATCGATA 5'
Dennis H.
You want to amplify a gene fragment by polymerase chain reaction (PCR). You have the following stocks: Template DNA, 10 µg/µl; forward primer, 10 µM; reverse primer, 10 µM; dNTP, 10 mM; 10X PCR buffer; and Taq polymerase, 10 U/µl. Each PCR reaction should have the following composition: 1 µg/100µl of template DNA, 1 µM of forward primer, 1 µM of reverse primer, 1X of buffer, 10 µM of dNTP, and 1 U of Taq polymerase. How will you make a 100 µl of PCR reaction mixture?
Jenny W.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD