The following is the nucleotide sequence of a strand of DNA from E. coli. CGTCCTCCAATCGCCCGTACCGTCTCCAGCGGAGATCTTTTCCGGTCGCAACTGAGGTTGATCAAC The strand is transcribed from left to right and codes for a small peptide. a) Is this the mRNA-like coding strand or template strand? b) Which end is the 3' end and which is the 5' end? c) What is the DNA coding strand sequence of the ORF? d) What is the sequence of the entire transcript (assume the +1 of transcription begins at the first nucleotide shown)? e) What is the amino acid sequence of the peptide?
Added by Miranda R.
Step 1
b) The template strand is read from 3' to 5', so the 3' end is on the left and the 5' end is on the right. c) Show more…
Show all steps
Your feedback will help us improve your experience
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
A template strand of a DNA molecule undergoing transcription reads 5’-AGCGATGTACGC-3’. A) What is the nucleotide sequence of the coding strand of the segment 5’-3’? B) What is the mRNA sequence? C) Which amino acids will the mRNA encode?
Madhur L.
The following DNA sequence occurs in the nontemplate strand of a structural gene in bacterium (the promoter sequence is located to the left but is not shown): 5'-GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3' a) What is the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA? b) What is the amino acid sequence encoded by this mRNA? Indicate both the amino terminal and carboxy terminal ends.
Adi S.
A geneticist isolates a strand of DNA containing the following nucleotide sequence: TACGGTCACATGATT a) Provide the nucleotide sequence of the mRNA strand transcribed from this sequence. b) What is the amino acid sequence of the polypeptide produced from this strand of mRNA? c) What is the nucleotide sequence of the tRNA anticodon that codes for the first amino acid in the polypeptide?
Dominador T.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD