The following non-template DNA sequence occurs near the middle of the coding region of a gene: 5’ AATGAATGGGAGCCTGAAGGA3’ There's a G to A base change at the position marked within an asterisk. Consequently, a codon normally encoding an amino acid becomes a stop codon. How will this alteration influence the process of DNA replication? How will this alteration influence the process of transcription? How will this alteration influence the process of translation?
Added by William W.
Step 1
Step 1: The alteration in the DNA sequence will lead to the formation of a premature stop codon, causing the translation process to be terminated prematurely. Show more…
Show all steps
Your feedback will help us improve your experience
Josee Pacheco and 76 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
How would a change to the sequence of nucleotides in a DNA segment affect the mRNA transcribed from the DNA?
Mystique T.
The template strand of a gene includes this sequence: 3' - TACCCGAACGATATC - 5' It is mutated to: 3' - TACGCGTCCAATATC - 5' For both the normal and mutant sequences, draw the double-stranded DNA, the resulting mRNA, and the amino acid sequence each encodes. What is the effect of the mutation on the amino acid sequence? Label the Start codon and Stop codons, if any.
Madhur L.
Describe some ways in which DNA is altered to cause mutations. a. A base substitution in the mRNA for an enzyme results in the replacement of leucine with alanine. Why does this change in amino acids have little effect on the biological activity of the enzyme? b. A base substitution in mRNA replaces cytosine in the codon UCA with adenine. How would this substitution affect the amino acids in the protein?
Nucleic Acids and Protein Synthesis
Genetic Mutations
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD