the following segment of DNA is the template strand transcribed into mRNA: 5'-...GACATGGAA ... -3' a. Whatt is the sequence of mRNA created from this sequence? what is the amino acid sequence produced by translation?
Added by Roberto O.
Step 1
- Complement each base: G→C, A→U, C→G, A→U, T→A, G→C, G→C, A→U, A→U - Write in 5'→3' direction (reverse the complement): 5'-UUCCAUGUC-3' Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 93 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The template strand of a segment of a double helical DNA contains the sequence ATGACTGTAGCTCGATCATAC. If this template strand was transcribed to produce mRNA, what would be the mRNA sequence? Then, if the mRNA was translated to produce a peptide, what would be the amino acid sequence of the resulting peptide?
Madhur L.
A DNA template strand is GATTACCGATCA: a) which MRNA would be made from this DNA template? b) How many amino acids would be in the protein if this mRNA were to be translated?
Syon S.
Using the template strand shown below, answer the following questions: 3' TACGCGGTATCCCAGGGCTAAATCAA 5' 1. What would the mRNA sequence be after transcription? 2. What would the amino acid sequence be after translation?
Sukhwinder N.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD