1. The following sequence of nucleotide pairs correspond to the 5' end (the "beginning") of the budhead gene from Hydra vulgaris and codes for 9 amino acids of the budhead protein. Strand A __'-ATTATTAGGTATAACCGTGTCCATCATGTTGTT- __' ||||||||||||||||||||||||||||||||| Strand B __'-TAATAATCCATATTGGCACAGGTAGTACAACAA- __' A) Identify the start codon (circle it on the appropriate strand). B) Indicate the 5' and 3' ends on both strands. C) Which strand is the template strand for transcription? A B (Circle one) D) Write the sequence (5' to 3') of the partial mRNA produced by the budhead sequence above. E) Write the primary structure of the N-terminus of the budhead protein based on the mRNA above. F) Write the sequence (5' to 3') of the tRNAs that could bind to codons 2, 3 and 4 of the mRNA. e1. 5'-___ ___ ___-3' e2. 5'-___ ___ ___-3' e3. 5'-___ ___ ___-3' G) What is the minimum number of different types of tRNAs that would have been involved in the synthesis of this 9 amino acid portion of the budhead protein? __________ H) Given the Wobble rules below, what is the minimum number of tRNAs that are needed for Serine? I) Based on your answer to the previous question, provide the sequence of the anticodons (written 3' to 5') of the two potential tRNA combinations for Serine. (6 points) Combination 1 Combination 2
Added by Miranda H.
Close
Step 1
Circle the start codon "AUG" on the coding strand: ATTATTAGGTATAACCGTGTCCATCATGTTGTT Show more…
Show all steps
Your feedback will help us improve your experience
Suman K and 81 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
What is the sequence of the second strand of DNA if the template has the following sequence (remember to follow the base pairing rules from above): DNA strand 1: T A C G C A DNA Strand 2: A T G C G T During DNA replication, the double stranded molecule is separated into 2 single stranded molecules and replication occurs using both strands as templates. Complete the replication of the two DNA strands below: T A C G C A A T G C G T Fill in each three base sequence (codon) from the mRNA you generated in the transcription above and the tRNA anticodon which will be complementary to those two codons. mRNA codons: A U G C G A tRNA anticodons: U A C G C U Look at the mRNA Codon Table on the next page. Translation occurs at the ribosomes when the tRNAs bring in their attached amino acids. Fill in the amino acids associated with the base sequences you used. Amino acids coded for: Methionine Arginine What is "translated" in this process? The base sequence in mRNA is translated into a sequence of amino acids. Summarize the process of forming a protein from a base sequence in DNA. Use the following key points in your summary: how bases pair up in transcription and translation, where transcription and translation occur and how is base pairing significant to the process. During transcription, the DNA sequence is used as a template to synthesize mRNA. Bases pair up according to the base pairing rules: A with U and G with C. Transcription occurs in the nucleus. During translation, the mRNA sequence is read by ribosomes and tRNAs bring in the corresponding amino acids based on the codons in the mRNA. Bases pair up again, this time between the codons in mRNA and the anticodons in tRNA. Translation occurs at the ribosomes in the cytoplasm. Base pairing is significant to the process as it ensures the correct sequence of amino acids is synthesized based on the DNA template. The complementary base pairing between DNA and mRNA allows for accurate transcription, while the complementary base pairing between mRNA and tRNA ensures the correct amino acids are brought in during translation.
Jackson M.
Given below are the complementary strands of DNA with the genetic sequences: DNA 5' STRAND DNA 3' STRAND A. In the following spaces, fill in the blanks to complete the appropriate RNA sequence of codons from the DNA sequence from left to right. The sequence must correspond to only one of the DNA strands given above. (5 points) RNA B. In the following spaces, fill in the blanks using Table 4.1 from the textbook to list the amino acids produced from the m-RNA. You may use the abbreviations provided by Table 4.1. (5 points) Amino Acids C. Match the given processes listed below to the substances that they generate that are mentioned in this problem. There are only three blanks, so one option will not be used. (5 points) Replication Transcription Translation D. From the sequence of amino acids, you encountered at least one "non-sense" codon. TRUE or FALSE? (5 points) E. Which of the three actually ‘carries’ the amino acids when converting from codons? m-RNA, t-RNA, or r-RNA? Choose only one (5 points)
Madhur L.
The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: $\quad$ GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU, UUC Asp: GAU, GAC These sequences are complementary to the sequences in DNA. a. Give the corresponding sequences in DNA for the amino acids listed above. b. Give a DNA sequence that would code for the peptide trp-glu-phe-met. c. How many different DNA sequences can code for the tetrapeptide in part b? d. What is the peptide that is produced from the DNA sequence T-A-C-C-T-G-A-A-G? e. What other DNA sequences would yield the same tripeptide as in part d?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD