The following shows a transcription bubble. Identify the 3' and the 5' ends of the transcript, coding, and template strands.
Added by Anna H.
Close
Step 1
Step 1: The coding strand of DNA is not transcribed, so we can eliminate it from consideration. Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 71 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Adi S.
Which of the following represents the sequence of an RNA transcript for which the coding strand (also known as non-template strand) of DNA has the sequence: GTACTGGCTAGCTGCTAGAA? Note all sequences are written 5’-3’.
Anand J.
The following sequence of nudeotides is found in a single-stranded DNA template: $ATTGCCAGATCATCCCAATAGAT$. Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is $5^{\prime}$ and which end is $3^{\prime} ?$ b. Give the sequence and identify the $5^{\prime}$ and $3^{\prime}$ ends of the RNA copied from this template.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD