Transcribe and translate the DNA sequence using the codon wheel. DNA: AAA GAG GGG What is the Amino Acid Sequence? Remember to use the mRNA sequence for the codon wheel. Write the three letter abbreviation in the blank.
Added by Stephen C.
Close
Step 1
The transcription rules are as follows: - A (adenine) pairs with U (uracil) - T (thymine) pairs with A (adenine) - C (cytosine) pairs with G (guanine) - G (guanine) pairs with C (cytosine) So, the mRNA sequence for the given DNA sequence AAA GAG GGG is: UUU CUC Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 93 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Translate the mRNA Sequence using the Codon Wheel. Your answer should be in the format, example: N-Ser-Tyr-Cys-C
Adi S.
Use the codon table below to translate this sequence to an amino acid sequence: CUAUACUAGAUUGCUAACAAGGGUUGG
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD