Transcribe and translate the sequence of DNA below. Finally, include the matching complementary DNA. Remember, the amino acids are based on mRNA codons.
3. Transcribe and translate the sequence of DNA below. Use the codon table from the textbook to determine the order of the amino acids in the protein chain. Finally, include the matching complementary DNA. Remember, the amino acids are based on the mRNA codons.
Complementary DNA:
DNA code:
TAC|CAC|AGATTTCCAGACGTATAATAGAAGCTACGTTGCATT
mRNA codon:
-
-
tRNA anticodon:
Amino acid: