Translate the following TWO sequences. Sequence Number one: 5'- AUG UUC GCA UAC CAG UGC ACU GUA GCA UCG UAG GCU UGA -3’ Sequence Number Two: 5’- UGC ACU GUA GCA UCG AUG UGC ACU GUA GCA UCG UAG UGC ACU GUA GCA UCG UAG UGC ACU GUA GCA -3’
Added by Aurora L.
Step 1
Step 1: Sequence Number one: 5'- AUG UUC GCA UAC CAG UGC ACU GUA GCA UCG UAG GCU UGA -3’ Translation: AUG (start codon) - UUC - GCA - UAC - CAG - UGC - ACU - GUA - GCA - UCG - UAG (stop codon) - GCU - UGA (stop codon) Translated amino acid sequence: Met - Phe - Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 96 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Use the codon table below to translate this sequence to an amino acid sequence: CUAUACUAGAUUGCUAACAAGGGUUGG
Adi S.
Translate the RNA sequence ACU GUU AAG GCA UGA into the corresponding amino acid sequence.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD