Use the genetic code that follows to translate this mRNA sequence UGA GGA Write the sequence of amino acids using the three-letter abbreviation First Position Amino Acid Second Position Amino Acid Last Position Amino Acid U C A G U UUU phe UCU ser UAU tyr UGU cys U C UUC UCC UAC UGC C A UUA leu UCA UAA stop UGA stop A G UUG UCG UAG stop UGG trp G C CUU leu CCU pro CAU his CGU arg U C CUC CCC CAC CGC C A CUA CCA CAA gln CGA A G CUG CCG CAG CGG G A AUU ile ACU thr AAU asn AGU ser U C AUC ACC AAC AGC C A AUA ACA AAA lys AGA arg A G AUG Start/met ACG AAG AGG G G GUU val GCU ala GAU asp GGU gly U C GUC GCC GAC GGC C A GUA GCA GAA glu GGA A G GUG GCG GAG GGG G
Added by Jason M.
Close
Step 1
The mRNA sequence given is: GUU AUG UAU GGU CAC UGA GGA Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 92 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Look at the following DNA region that codes for a specific gene: Coding strand: ATGTGCCCGAATGTTCTATAG Template strand: TACACGGGCTTACAAGATATC Write down the sequence of the mRNA that will be transcribed from this sequence: Using the Genetic code table, translate the mRNA into amino acids: How many codons does the mRNA have? How many amino acids does the polypeptide have? In eukaryotes, where do the processes of translation and transcription take place? Second letter: UUU - Phenylalanine UUC - Phenylalanine UUA - Leucine UUG - Leucine UCU - Serine UCC - Serine UCA - Serine UCG - Serine UAU - Tyrosine UAC - Tyrosine UGU - Cysteine UGC - Cysteine UAA - Stop codon UGA - Stop codon UAG - Stop codon UGG - Tryptophan CUU - Leucine CUC - Leucine CUA - Leucine CUG - Leucine CCU - Proline CCC - Proline CCA - Proline CCG - Proline CAU - Histidine CAC - Histidine CGU - Arginine CGC - Arginine CGA - Arginine CGG - Arginine CAA - Glutamine CAG - Glutamine AUU - Isoleucine AAU - Asparagine AGU - Serine ACU - Threonine AAC - Asparagine AGC - Serine AUC - Isoleucine ACC - Threonine AUA - Isoleucine ACG - Threonine AGA - Arginine AUG - Methionine ACG - Threonine AAG - Lysine AGG - Arginine GUU - Valine GCU - Alanine GAU - Aspartic acid GGU - Glycine GUC - Valine GCC - Alanine GAC - Aspartic acid GGC - Glycine GUA - Valine GCA - Alanine GAA - Glutamic acid GGA - Glycine GCG - Glutamic acid GUG - Valine GAG - Glutamic acid GGG - Glycine
Adi S.
Type the amino acid sequence if you translate the mRNA you produced for the previous answer. Type the sequence in red in the space below. Use the three-letter code for amino acids.
Shaiju T.
Below is a template strand of DNA that contains a translation start codon. 5’ – CTTTACGGGATGGCATTG – 3’ a) Assuming this entire sequence is transcribed, write the sequence of the resulting mRNA transcript including appropriate end labels. b) Write the sequence of the polypeptide resulting from this transcript,
Mj A.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD