If a genetic mistake (i.e., a mutation) occurred during replication and the new DNA strand has the sequence CAG, what amino acid would result? Show each step. (1 point each) mRNA codon: tRNA anticodon: amino acid:
Added by Francisca V.
Step 1
Let's think step by step. Show more…
Show all steps
Your feedback will help us improve your experience
Marlyn Joyce and 98 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
4. The following sequence of questions (a-c) illustrates how the duplication in coding for amino acids can minimize the impact of point mutations in DNA. For each scenario, show the products (mRNA codon, tRNA anticodon, and amino acid) for each step of the process. a. Which amino acid would be produced if transcription took place from the DNA sequence CAT? DNA sequence: C A T mRNA codon: __________________________ tRNA anticodon: __________________________ amino acid: __________________________ b. If a genetic mistake (a mutation) occurred during replication and the new DNA strand has the sequence CAG, which amino acid would result? DNA sequence: C A G mRNA codon: __________________________ tRNA anticodon: __________________________ amino acid: __________________________ c. What if the mutation resulted in a DNA strand with the sequence GAT? DNA sequence: G A T mRNA codon: __________________________ tRNA anticodon: __________________________ amino acid: __________________________
Marlyn J.
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5' ) CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3' ) 3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5' ) CGUUACAAUGUAU_CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short polypeptide will exist in this mutant cell?
Adi S.
A. What amino acid sequence would result from translation of the following mRNA molecule? mRNA: 5' - AUG CGG UUA UUG CUA CUG UCA UAG - 3' Polypeptide: (Use the 3 letter codes with spaces in between each amino acid) B. There is a mutation in the DNA so that the mRNA sequence also altered as show below (mutation in bold): mutant mRNA: 5' - AUG CGG UUU AUU GCU ACU GUC AUA G - 3' What two terms could be used to describe this mutation? (hint: one describes how the DNA is changed, the other describes the effect that change has)
Rachel G.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD