If DNA is heated to 95°C, the bonds between complementary strands break. In this process, which bases will likely separate last?
Added by Tyler M.
Step 1
GC pairs (three H-bonds) are more stable than AT pairs (two H-bonds). Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 61 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
If a DNA double helix is gradually heated which bonds in the molecule will break first
Adi S.
The complementary strands of DNA in the double helix are held together by hydrogen bonds: $G \equiv C$ or $A=T$ These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA (see Figure $1-13$ a). How would you expect the relative amounts of GC versus AT base pairs in a DNA double helix to affect the amount of heat required to denature it? How would you expect the length of a DNA double helix in base pairs to affect the amount of heat required to denature it?
Heat can be used to separate the two strands of a DNA double helix. The thermal stability of a DNA double helix depends largely on the number of hydrogen bonds holding the two strands of the double helix together and the impact of surrounding bases. Which of the following DNA sequences will be most heat stable in a solution that contains 150 mM NaCl, 150 µM Mg2+, and 1 nM oligonucleotide? A) 5’ AATAGATTTGACAATATAATTATA 3’ B) 5’ GGTACGTGAGAULALACGGA 3’ C) 5’ GCGCGCGCGCGCGCGCGCGC 3’ and 5’ GGGGGGGGGGGGGGGGGGGG 3’ will be the same because both strands have the exact same number of GC base pairs and thus the exact same number of hydrogen bonds between the bases. D) 5’ GGGGGGGGGGGGGGGGGGGG 3’ E) 5’ GCGCGCGCGCGCGCGCGCGC 3’
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD