The coding/non-template strand from the (short and made-up) weekend has the sequence indicated below. EXONS are UNDERLINED AND CAPITALIZED. 5' agcattctgattcAGTCCTACCGTctagtaacctagtCTACGGCgatattGGACGATC tcactgac 3' What is the sequence of the mature mRNA produced from this DNA? 5' cuaguaaccuagucgauauu 3' 5' GAUCGUCCCCGUAGACGGUAGACU 3' 5' agcattctgattcAGTCCTACCGTctagtaacctagtCTACGGCgatattGGACGATC tcactgac 3' 5' AGUCUACCGUCUACGGGGACGACU 3' 5' GATCGTCCaatatcgCCGTAGactaggttactagACGGTGAGACT 3' 5' aatatcgactaggttactag 3' 5' AGTCTACCGTctagtaacctagtCTACGGCgatattGGACGATC 3' 5' agcauucugauucAGUCUACCGCUcuaguaaccuaguCUACGGCgauauuGGACG AUCucacugac 3' 5' AGUCUACCGCUcuaguaaccuaguCUACGGCgauauuGGACGACUC 3'
Added by William H.
Close
Step 1
The given DNA sequence is the coding/non-template strand: 5' agcattctgattcAGTCCTACCGTctagtaacctagtCTACGGCgatattGGACGATC tcactgac 3' Exons are defined as UNDERLINED AND CAPITALIZED. So, the exons are: AGTCCTACCGT, CTACGGC, and GGACGATC. The non-exonic regions Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 73 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCGGaatcgaGGTCAGATGC CGATTTACCGTtttaacggcctactgCGTGTAACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
Sri K.
Here is a sequence from the non-template DNA strand of a gene: 5'-ATGCTGACTG-3'. What mRNA would be transcribed from this sequence? 5'-AUGCUGACUG-3' 5'-TACGACTGAG-3' 5'-UACGACUGAC-3' 5'-ATGCTGACTG-3' 5'-CAGUCAGCAU-3'
Marlyn J.
Farhan A.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD