Question

You are studying an oncogene in humans and have isolated an mRNA that is expressed only in cancer cells. You have generated a cDNA from this mRNA using Reverse Transcriptase which you can then amplify using PCR for standard DNA sequencing. The sequence of the PCR product that you generated is shown below. Both strands are shown. 5'-AGCCACCATGGCGGATGAATTACCCGCATTGGCCATACCTAAATCCTAGAAAAAAAA 3'-TCGGTGGTACCGCCTACTTTAATGGGCGTAACCGGTATGGATTTAGGATCTTTTTTTT Now that you know the sequence, you are planning to genetically engineer E. coli cells to produce the abnormal polypeptide encoded by this oncogene mRNA so you can study its molecular function and possibly develop a drug treatment for this type of cancer. In order to have E. coli express the protein, you need to PCR amplify ONLY the open reading frame (ORF) so you can insert it into a vector with the proper E. coli signals for expression (e.g. Pribnow box, Shine-Dalgarno sequence, bacterial terminator etc). What primer sequences do you need to amplify just the open reading frame on this cDNA? Mutations in the BRCA (breast cancer susceptibility protein) genes are known to cause heritable susceptibility to breast cancer. On the molecular level, the BRCA proteins are involved in the repair of DNA double strand breaks. When patients carrying a recessive mutation in the gene are losing the function of the second allele due to another mutation, the resulting tumor cells will rapidly accumulate additional mutations. What type of mutagen would be the most detrimental to the DNA in this type of "BRCA knockout" tumor? Select one: Chemicals that cause base substitutions All mutagens would be equally detrimental Chemicals that intercalate into the DNA and cause frameshifts Non-ionizing radiation, such as UV radiation Ionizing radiation, such as X-rays or gamma radiation Mutations in the CF gene cause the genetic disorder cystic fibrosis in humans. Researchers have found that the normal gene encodes a protein that functions in the transport of chloride ions across the cell membrane and that the protein from the mutated gene doesn't transport chloride ions very well. What is this research an example of? Select one: a. Transmission genetics b. Conservation genetics c. Population genetics d. Evolutionary genetics e. Molecular genetics

You are studying an oncogene in humans and have isolated an mRNA that is expressed only in cancer cells. You have generated a cDNA from this mRNA using Reverse Transcriptase which you can then amplify using PCR for standard DNA sequencing. The sequence of the PCR product that you generated is shown below. Both strands are shown.

5'-AGCCACCATGGCGGATGAATTACCCGCATTGGCCATACCTAAATCCTAGAAAAAAAA
3'-TCGGTGGTACCGCCTACTTTAATGGGCGTAACCGGTATGGATTTAGGATCTTTTTTTT

Now that you know the sequence, you are planning to genetically engineer E. coli cells to produce the abnormal polypeptide encoded by this oncogene mRNA so you can study its molecular function and possibly develop a drug treatment for this type of cancer. In order to have E. coli express the protein, you need to PCR amplify ONLY the open reading frame (ORF) so you can insert it into a vector with the proper E. coli signals for expression (e.g. Pribnow box, Shine-Dalgarno sequence, bacterial terminator etc). What primer sequences do you need to amplify just the open reading frame on this cDNA?

Mutations in the BRCA (breast cancer susceptibility protein) genes are known to cause heritable susceptibility to breast cancer. On the molecular level, the BRCA proteins are involved in the repair of DNA double strand breaks. When patients carrying a recessive mutation in the gene are losing the function of the second allele due to another mutation, the resulting tumor cells will rapidly accumulate additional mutations. What type of mutagen would be the most detrimental to the DNA in this type of "BRCA knockout" tumor?

Select one:
Chemicals that cause base substitutions
All mutagens would be equally detrimental
Chemicals that intercalate into the DNA and cause frameshifts
Non-ionizing radiation, such as UV radiation
Ionizing radiation, such as X-rays or gamma radiation

Mutations in the CF gene cause the genetic disorder cystic fibrosis in humans. Researchers have found that the normal gene encodes a protein that functions in the transport of chloride ions across the cell membrane and that the protein from the mutated gene doesn't transport chloride ions very well. What is this research an example of?

Select one:
a. Transmission genetics
b. Conservation genetics
c. Population genetics
d. Evolutionary genetics
e. Molecular genetics

You are studying an oncogene in humans and have isolated an mRNA that is expressed only in cancer cells. You have generated a cDNA from this mRNA using Reverse Transcriptase which you can then amplify using PCR for standard DNA sequencing. The sequence of the PCR product that you generated is shown below. Both strands are shown.

5'-AGCCACCATGGCGGATGAATTACCCGCATTGGCCATACCTAAATCCTAGAAAAAAAA
3'-TCGGTGGTACCGCCTACTTTAATGGGCGTAACCGGTATGGATTTAGGATCTTTTTTTT

Now that you know the sequence, you are planning to genetically engineer E. coli cells to produce the abnormal polypeptide encoded by this oncogene mRNA so you can study its molecular function and possibly develop a drug treatment for this type of cancer. In order to have E. coli express the protein, you need to PCR amplify ONLY the open reading frame (ORF) so you can insert it into a vector with the proper E. coli signals for expression (e.g. Pribnow box, Shine-Dalgarno sequence, bacterial terminator etc). What primer sequences do you need to amplify just the open reading frame on this cDNA?

Mutations in the BRCA (breast cancer susceptibility protein) genes are known to cause heritable susceptibility to breast cancer. On the molecular level, the BRCA proteins are involved in the repair of DNA double strand breaks. When patients carrying a recessive mutation in the gene are losing the function of the second allele due to another mutation, the resulting tumor cells will rapidly accumulate additional mutations. What type of mutagen would be the most detrimental to the DNA in this type of "BRCA knockout" tumor?

Select one:
Chemicals that cause base substitutions
All mutagens would be equally detrimental
Chemicals that intercalate into the DNA and cause frameshifts
Non-ionizing radiation, such as UV radiation
Ionizing radiation, such as X-rays or gamma radiation

Mutations in the CF gene cause the genetic disorder cystic fibrosis in humans. Researchers have found that the normal gene encodes a protein that functions in the transport of chloride ions across the cell membrane and that the protein from the mutated gene doesn't transport chloride ions very well. What is this research an example of?

Select one:
a. Transmission genetics
b. Conservation genetics
c. Population genetics
d. Evolutionary genetics
e. Molecular genetics

Added by Megan B.

Question

Please give Ace some feedback