Chapter 3, An Introduction to Gene Function Video Solutions, Molecular Biology

01:36

Problem 1

Draw the general structure of an amino acid.

Mariana Roldan

Numerade Educator

03:50

Here is the sequence of a portion of a bacterial gene:
2'GTATCGTATGCATGCATCGTGAC3'
3'CATAGCATACGTACGTAGCACTG
The template strand is on the bottom. (a) Assuming that transcription starts with the first $\mathrm{T}$ in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
(b) Find the initiation codon in this mRNA. (c) Would there be an effect on translation of changing the first $\mathrm{G}$ in the template strand to a $\mathrm{C}$ ? If so, what effect?
(d) Would there be an effect on translation of changing the second $T$ in the template strand to a G? If so, what effect? (e) Would there be an effect on translation of changing the last $\mathrm{T}$ in the template strand to a C? If so, what effect?

Shiksha Dutta

Numerade Educator

00:23

Problem 2

Draw the structure of a peptide bond.

Niamat Khuda

Numerade Educator

05:23

Problem 2

You are performing genetic experiments on Neurospora crassa, similar to the ones Beadle and Tatum did. You isolate one pantothenateless mutant that cannot synthesize pantothenate unless you supply it with pantoate. What step in the pantothenate pathway is blocked?

Amy Jackson

Numerade Educator

07:01

Problem 3

Use a rough diagram to compare the structures of a protein $\alpha$-helix and an antiparallel $\beta$-sheet. For simplicity, show only the backbone atoms of the protein.