• Home
  • Textbooks
  • Genetics: From Genes to Genomes
  • Gene Regulation in Prokaryotes

Genetics: From Genes to Genomes

Leland Hartwell, Michael L. Goldberg, Janice Fischer

Chapter 16

Gene Regulation in Prokaryotes - all with Video Answers

Educators

+ 4 more educators

Chapter Questions

View

Problem 1

For each of the terms in the left column, choose the best matching phrase in the right column.
a. induction
b. repressor
c. operator
d. allostery
e. operon
$\mathrm{f}$. catabolite
repression
g. reporter gene
h. attenuation
i. sRNA
j. riboswitch
1. glucose prevents expression of catabolic operons
2. protein or RNA undergoes a reversible conformational change
3. regulates translation of mRNAs in trans
4. RNA leader that regulates gene expression in response to a small molecule or ion
5. site to which repressor binds
6. termination of transcription elongation in response to translation
7. group of genes transcribed into one mRNA
8. negative regulator
9. a fusion of the regulatory region of one gene to the coding region of another gene whose product is assayed readily
10. stimulation of protein synthesis by a specific molecule

Marisa A
Marisa A
Numerade Educator
03:56

Problem 2

The following statement occurs early in this chapter:
$" . .$ a crucial step in the regulation of many bacterial genes is the binding of RNA polymerase to DNA at the promoter." Why might it be advantageous for bacteria to regulate the expression of their genes at this particular step?

Dennis Howard
Dennis Howard
Numerade Educator
View

Problem 3

One of the main lessons of this chapter is that several bacterial genes are often transcribed from a single promoter into a large multigene (polycistronic) transcript. The region of DNA containing the set of genes that are cotranscribed, along with all of the regulatory elements that control the expression of these genes, is called an operon.
a. Which of the mechanisms in the following list could explain differences in the levels of the mRNAs for different operons?
b. Which of the mechanisms in the following list could explain differences in the levels of the protein products of different genes in the same operon?
i. Different promoters might have different DNA sequences.
ii. Different promoters might be recognized by different types of RNA polymerase.
iii. The secondary structures of mRNAs might differ so as to influence the rate at which they are degraded by ribonucleases.
iv. In an operon, some genes are farther away from the promoter than other genes.
v. The translational initiation sequences at the beginning of different open reading frames in an operon might result in different efficiencies of translation.
vi. Proteins encoded by different genes in an operon might have different stabilities.

Sana Riaz
Sana Riaz
Numerade Educator
02:32

Problem 4

All mutations that abolish function of the Rho termination protein in $E .$ coli are conditional mutations; no cells with null mutations of the Rho-encoding gene have cver becn isolated. What does this tell you about the rho gene and its product?

Jenny Wu
Jenny Wu
Numerade Educator
03:14

Problem 5

The figure at the beginning of this chapter shows the binding of both a Lac repressor tetramer and a CRP-cAMP complex to the regulatory region of the lac operon.
a. What is the key feature of a regulatory protein such as the Lac repressor or CRP that allows it to regulate specifically the genes or operons it is supposed to control?
b. On the figure, show the positions of the following components:
(i) A Lac repressor monomer; (ii) a Lac repressor dimer; (iii) all four DNA binding domains of the Lac repressor tetramer; (iv) a single helix-turnhelix motif; (v) the o part and either the $0_{2}$ or $0_{3}$ parts of the lac operator (assume the operon would be transcribed from right to left on the figure); (vi) the multimerization domains of the four Lac repressor monomers; (vii) an inducer-interacting domain; (viii) the CRP-cAMP complex; and (ix) a DNA loop.
c. What is the physical basis for the formation of the DNA loop shown in the figure?
d. On the figure, show the position of two axes of symmetry in the sequence of DNA. How do you know, only on the basis of the figure and without prior information about the precise DNA sequence, that these two axes of symmetry are likely to be present in the DNA and that the sequences around these axes are rotationally symmetrical?

Jessica Wooten
Jessica Wooten
Numerade Educator
View

Problem 6

The promoter of an operon is the site to which $\mathrm{RNA}$ polymerase binds to begin transcription. Certain base changes in the promoter result in a mutant site to which RNA polymerase cannot bind. Would you expect mutations in the promoter that prevent binding of RNA polymerase to act in trans on another copy of the operon on a plasmid in the cell, or only in cis on the copy immediately adjacent to the mutated site?

Farhan Anwar
Farhan Anwar
Numerade Educator
07:48

Problem 7

You are studying an operon containing three genes that are cotranscribed in the order hup $F,$ hup $H,$ and hup$G .$ Diagram the mRNA for this operon, showing the location of the $5^{\prime}$ and $3^{\prime}$ ends, all open reading frames, translational start sites, stop codons, transcription termination signals, and any regions that might be in the mRNA but do not serve any of these functions.

Shiksha Dutta
Shiksha Dutta
Numerade Educator
View

Problem 8

You have isolated a protein that binds to DNA in the region upstream of the promoter sequence of the sys gene. If this protein is a positive regulator, which of the following would be true?
a. Loss-of-function mutations in the gene encoding the DNA-binding protein would cause constitutive expression of sys.
b. Loss-of-function mutations in the gene encoding the DNA-binding protein would result in little or no expression of sys.

Farhan Anwar
Farhan Anwar
Numerade Educator
02:16

Problem 9

You have isolated two different mutants (reg $l$ and reg 2 ) causing constitutive expression of the emu operon (emul emu2). One mutant contains a defect in a DNA-binding site, and the other has a loss-of-function defect in the gene encoding a protein that binds to the site.
a. Is the DNA-binding protein a positive or negative regulator of gene expression?
b. To determine which mutant has a defect in the site and which one has a mutation in the binding protein, you decide to do an analysis using $\mathrm{F}^{\prime}$ plasmids. Assuming you can assay levels of the Emul and Emu2 proteins, what results do you predict for the two strains (i and ii; see descriptions below) if reg 2 encodes the regulatory protein and reg 1 is the regulatory site?
i. $F^{\prime}\left(\text {reg} I^{-} \text {reg} 2^{+} \text {emul}^{-} \text {emu} 2^{+}\right)$
reg$I^{+}$reg $2^{+}$emul$^{+}$emu $2^{-}$
ii. $\quad F^{\prime}\left(\text {reg} I^{+} \text {reg} 2^{-} \text {emul}^{-} \text {emu} 2^{+}\right) /$
reg$I^{+}$reg $2^{+}$emul$^{+}$emu $2^{-}$
c. What results do you predict for the two strains (i and ii) if reg 1 encodes the regulatory protein and $r e g 2$ is the regulatory site?

Mikayla Stephens
Mikayla Stephens
Numerade Educator
00:47

Problem 10

Bacteriophage $\lambda,$ after infecting a cell, can integrate into the chromosome of the cell if the repressor protein, $\mathrm{cI}$, binds to and shuts down phage transcription immediately. (A strain containing a bacteriophage DNA integrated into the chromosome is called a lysogen. The alternative fate is the production of many more viruses and lysis of the cell. In a mating, a donor strain that is a lysogen was crossed with a lysogenic recipient cell, and no phages were produced. However, when the lysogen donor strain transferred its DNA to a nonlysogenic recipient cell, the recipient cell burst, releasing a new generation of phages.
a. Why did the mating with a nonlysogenic recipient result in phage growth and release, but the infection of a lysogenic recipient did not?
b. Explain how this phenomenon relates to the PaJaMo experiment in Fig. 16.6
c. Explain how this phenomenon relates to hybrid dysgenesis, described in Problem 29 of Chapter 13

Eleanor Behling
Eleanor Behling
Numerade Educator
01:29

Problem 11

Mutants were isolated in which the constitutive phenotype of a missense $l a c I$ mutation was suppressed. That is, the operon was now inducible. These suppressor mutations mapped to the operon, not to the $\operatorname{lac} I$ gene. What could these mutations be?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
04:46

Problem 12

Suppose you have six strains of $E .$ coli. One is wild type, and each of the other five has a single one of the following mutations: $\operatorname{lac} Z,$ lac $Y$, $\operatorname{lac} \Gamma, o^{c}$, and lac $I^{S}$. For each of these six strains, describe the phenotype you would observe using the following assays. [Notes: (1) IPTG is a colorless synthetic molecule that acts as an inducer of lac operon expression but cannot serve as a carbon source for bacterial growth because it cannot be cleaved by \beta-galactosidase; (2) X-gal cannot serve as a carbon source for growth; (3)$E$ coli requires active lactose permease (the product of $\operatorname{lac} Y$ ) to allow lactose, X-gal, or IPTG into the cells.
a. Growth on medium in which the only carbon source was lactose.
b. Colony color in medium containing glycerol as the only carbon source, X-gal, and IPTG.
c. Colony color in medium containing glycerol as the only carbon source and X-gal, but no IPTG.
d. Colony color in medium containing high levels of glucose as the only carbon source, X-gal, and IPTG.
e. Colony color in medium containing high levels of glucose as the only carbon source and X-gal, but no IPTG.

James Kiss
James Kiss
Numerade Educator
03:37

Problem 13

The previous problem raises some interesting issues:
a. In most experiments using the lac operon, researchers use the synthetic inducer IPTG to turn on operon expression, instead of lactose or allolactose. What do you think is the advantage of using IPTG?
b. Scientists were originally puzzled by what they termed the lactose paradox. To turn on expression of the $l a c$ operon, an inducer (whether IPTG or lactose/allolactose) needs to be able to get into the cell. Import of this inducer requires the presence of the Lac permease enzyme in the cell membrane (Fig. 16.2 ). But if the $l a c$ operon is being repressed prior to addition of the inducer, no Lac permease should be present, so no inducer could be imported, and induction could never occur. Yet induction obviously does occur; how might this be possible?

Hannah Vigran
Hannah Vigran
Numerade Educator
06:50

Problem 14

For each of the $E$. coli strains containing the lac operon alleles listed, indicate whether the strain is inducible, constitutive, or unable to express \beta-galactosidase and permease.
a. $I^{+} o^{+} Z Y^{+} / I^{+} o^{c} Z^{+} Y^{+}$
b. $I^{+} o^{+} Z^{+} Y^{+} / I^{-} o^{c} Z^{+} Y^{-}$
c. $I^{+} o^{+} Z Y^{+} / I^{-} o^{c} Z^{+} Y$
d. $\Gamma P^{-} o^{+} Z^{+} Y / I^{+} P^{+} o^{c} Z Y^{+}$
e. $I^{s} o^{+} Z^{+} Y^{+} / \Gamma o^{+} Z^{+} Y^{-}$

Susan Hallstrom
Susan Hallstrom
Numerade Educator
View

Problem 15

For each of the following growth conditions, what proteins would be bound to lac operon DNA? (List the proteins, but do not include RNA polymerase.)
a. glucose
b. glucose $+$ lactose
c. lactose

Farhan Anwar
Farhan Anwar
Numerade Educator
02:54

Problem 16

For each of the following mutant $E .$ coli strains, plot a 30 -minute time course of concentration of \beta-galactosidase, permease, and acetylase enzymes grown under the following conditions: For the first 10 minutes, no lactose is present; at 10 minutes, lactose becomes the sole carbon source. Plot concentration on the y-axis, time on the x-axis. (Don't worry about the exact units for each protein on the y-axis.)
a. $\Gamma P^{+} o^{+} Z^{+} Y^{+} A^{+} / I^{+} P^{+} o^{+} Z Y^{+} A^{+}$
b. $\Gamma P^{+} o^{c} Z^{+} Y^{+} A^{-} / I^{+} P^{+} o^{+} Z Y^{+} A^{+}$
c. $\left\lceil P^{+} o^{+} Z^{+} Y^{+} A^{+} / I^{-} P^{+} o^{+} Z Y^{+} A^{+}\right.$
d. $\Gamma P^{-} o^{+} Z^{+} Y^{+} A^{+} / I^{-} P^{+} o^{c} Z^{+} Y^{-} A^{+}$
e. $\Gamma P^{+} o^{+} Z Y^{+} A^{+} / I^{-} P^{-} o^{c} Z^{+} Y^{-} A^{+}$

Danielle Ashley
Danielle Ashley
Numerade Educator
01:59

Problem 17

Maltose utilization in $E .$ coli requires the proteins encoded by genes in three different operons. One operon includes the genes malE, malF, and malG; the second includes malK and $l a m B ;$ and the genes in the third operon are malP and malQ. The MalT protein is a positive regulator that controls the expression of all three operons; expression of the malT gene itself is catabolite sensitive.
a. What phenotype would you expect to result from a loss-of-function mutation in the malT gene?
b. Do you expect the three maltose operons to contain binding sites for CRP (cAMP receptor protein)? Why or why not?
In order to infect $E .$ coli, bacteriophage $\lambda$ binds to the maltose transport protein LamB (also known as the $\lambda$ receptor protein that is found in the outer membrane of the bacterial cell. The synthesis of LamB is induced by maltose in the medium via expression of the MalT protein, as described above.
c. List the culture conditions under which wild-type
$E$ coli cells would be sensitive to infection by bacteriophage $\lambda$
d. $E .$ coli cells that are resistant to infection by bacteriophage $\lambda$ have been isolated. List the types of mutations in the maltose regulon (the set of all genes regulated by maltose ) that $\lambda$ -resistant mutants could contain.

Jennifer Stoner
Jennifer Stoner
Numerade Educator
04:46

Problem 18

Seven $E$. coli mutants were isolated. The activity of the enzyme $\beta$ -galactosidase produced by cells containing each mutation alone or in combination with other mutations was measured when the cells were grown in medium with different carbon sources.
$$\begin{array}{lcrc}
& & & \text { Lactose }+ \\
& \text { Glycerol } & \text { Lactose } & \text { Glucose } \\
\hline \text { Wild type } & 0 & 1000 & 10 \\
\text { Mutant 1 } & 0 & 10 & 10 \\
\text { Mutant 2 } & 0 & 10 & 10 \\
\text { Mutant 3 } & 0 & 0 & 0 \\
\text { Mutant 4 } & 0 & 0 & 0 \\
\text { Mutant 5 } & 1000 & 1000 & 10 \\
\text { Mutant 6 } & 1000 & 1000 & 10 \\
\text { Mutant 7 } & 0 & 1000 & 10 \\
\mathrm{F}^{\prime} \text { lac from mutant } & 0 & 1000 & 10 \\
\text { 1/ mutant 3 } & & & \\
\text { F' lac from mutant } & 0 & 10 & 10 \\
\text { 2/ mutant 3 } & & & \\
\text { Mutants 3 + 7 } & 0 & 1000 & 10 \\
\text { Mutants 4 + 7 } & 0 & 0 & 0 \\
\text { Mutants 5 + 7 } & 0 & 1000 & 10 \\
\text { Mutants 6 + 7 } & 1000 & 1000 & 10
\end{array}$$
Assume that each of the seven mutations is one and only one of the genetic lesions in the following list. Identify the type of alteration each mutation represents.
a. superrepressor
b. operator deletion
c. nonsense (amber) suppressor tRNA gene (assume that the suppressor tRNA is $100 \%$ efficient in suppressing amber mutations)
d. defective CRP-cAMP binding site
e. nonsense (amber) mutation in the $\beta$ -galactosidase gene
f. nonsense (amber) mutation in the repressor gene
g. defective crp gene (encoding the CRP protein)

James Kiss
James Kiss
Numerade Educator
12:02

Problem 19

Cells containing missense mutations in the crp gene (encoding the positive regulator CRP) are Lac", MalGal', etc. To find cells with suppressors of the $c r p$ mutation (that is, cells with the $c r p$ mutation that behave as if they are $c r p^{+}$ ), cells were screened to find those that were both $\mathrm{Lac}^{+}$ and $\mathrm{Mal}^{+}$
a. What types of suppressor mutations would you expect to obtain using this screen compared with a screen for $\mathrm{Lac}^{+}$ only?
b. All suppressors isolated were mutant in the gene for the $\alpha$ -subunit of RNA polymerase. What hypothesis could you propose based on this analysis?

Jenny Wu
Jenny Wu
Numerade Educator
04:46

Problem 20

Six strains of $E .$ coli (mutants $1-6$ ) that had one of the following mutations (i-vi) affecting the lac operon were isolated.
i. deletion of $\operatorname{lac} Y$
ii. $o^{c}$ mutation
iii. missense mutation in $\operatorname{lac} Z$
iv. inversion of the lac operon (but not an inversion of the $\operatorname{lac} I$ gene
v. superrepressor mutation
vi. inversion of $\operatorname{lacZ}, Y$, and $A$ but not $\operatorname{lac} I, P, o$
a. Which of these mutations would prevent the strain from utilizing lactose?
b. The entire lac operon (including the lacI gene and its promoter) from each of the six $E .$ coli strains was cloned into a plasmid vector containing an ampicillin resistance gene. Each recombinant plasmid was transformed into each of the six strains to create partial diploids. In analysis of these strains, mutant 1 was found to carry a deletion of $\operatorname{lac} Y$, so this strain corresponds to mutation i in the list above. Which of the other types of mutations would be expected to complement mutant 1 in these partial diploids so as to allow lactose utilization?
c. In part (b), each strain was plated on ampicillin media in which lactose was the only carbon source. (Ampicillin was included to ensure maintenance of the plasmid.) Growth of the transformants is scored below (a + sign indicates growth, a - sign means no growth). Synthesis of $\beta$ -galactosidase and permease are both required for growth on this medium. Results of this merodiploid analysis are shown here. Which mutant bacterial strain (1-6) contained each of the alterations (i-vi) listed previously?
$$\begin{array}{rrrrrr}
& 1 & 2 & 3 & 4 & 5 & 6 \\
1 & - & + & - & + & - & + \\
2 & + & - & - & + & - & + \\
3 & - & - & - & + & - & + \\
4 & + & + & + & + & - & + \\
5 & - & - & - & - & - & + \\
6 & + & + & + & + & + & +
\end{array}$$

James Kiss
James Kiss
Numerade Educator
12:02

Problem 21

a. The original constitutive operator mutations in the lac operon were all base changes in o $_{1}$. Why do you think mutations in $\mathrm{o}_{2}$ or $\mathrm{o}_{3}$ were not isolated in these screens?
b. Explain how a mutagen that causes small insertions could produce an $o^{c}$ mutation.
c. Would a strain with one of the $o^{c}$ mutations described in part (b) and also a $\operatorname{lac} I^{S}$ mutation be able to make $\beta$ -galactosidase either in the presence or absence of inducer? Explain.

Jenny Wu
Jenny Wu
Numerade Educator
02:15

Problem 22

In an effort to determine the location of an operator site for a negatively regulated gene, you have made a series of deletions within the regulatory region. The extent of each deletion is shown by the line underneath the sequence, and the resulting expression from the operon $(i=\text { inducible } ; c=\text { constitutive; }-=\text { no expression })$ is also indicated.
$1 i$ _______
$2-$ _______
$3 c$ ________
$4-$ _______
$5 c$ ________
a. What can you conclude from these data about the location of the operator site?
b. Why do you think deletions 2 and 4 show no expression of the gene?

James Kiss
James Kiss
Numerade Educator
01:08

Problem 23

Figure 16.17 shows that in the $l a c$ operon, both the operator $\left(\mathrm{o}_{1}\right)$ and the binding site for $\mathrm{CRP}$ -cAMP show rotational symmetry. This is not true of the promoter (the RNA polymerase binding site) as a whole. Why do you think the promoter does not exhibit rotational symmetry?

James Kiss
James Kiss
Numerade Educator
02:07

Problem 24

The footprinting experiment described in Fig. 16.16 depended on having a fragment of double-stranded DNA that was labeled with radioactivity at one end of one strand.
a. How would you make such a labeled fragment of DNA? Outline the steps you would perform, starting with two PCR primers and some genomic DNA. You also have available a kinase enzyme that adds phosphate groups to the $5^{\prime}$ ends of DNA strands, radioactive ATP, and a restriction enzyme of your choice. You could also use a phosphatase enzyme that removes phosphate groups from the $5^{\prime}$ ends of DNA strands.
b. Why does the footprinting experiment require a fragment of DNA labeled only on one end of one strand? In other words, how would the results of the experiment differ from those shown in Fig. 16.16 if the DNA was labeled on both strands at their $5^{\prime}$ ends, or if the DNA was labeled with radioactive phosphate along its entire length at every phosphodiester bond?

James Kiss
James Kiss
Numerade Educator
04:05

Problem 25

Why is the $t r p$ attenuation mechanism unique to prokaryotes?

Dhanya K
Dhanya K
Numerade Educator
View

Problem 26

a. How many ribosomes are required (at a minimum) for the translation of $t r p E$ and $t r p C$ from a single transcript of the $t r p$ operon?
b. How would you expect deletion of the two tryptophan codons in the RNA leader to affect the expression of the $t r p E$ and $t r p C$ genes?

Rashmi Sinha
Rashmi Sinha
Numerade Educator
03:25

Problem 27

The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?
$5^{\prime}$ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCA
UCCUGACUAGUCUUUCAGGC 3'

Khalida Dawar
Khalida Dawar
Numerade Educator
04:14

Problem 28

For each of the $E$. coli strains that follow, indicate the effect of the genotype on the expression of the $\operatorname{trp} E$ and trp $C$ genes in the presence or absence of tryptophan. [In the wild type $(R^{+} P^{+} o^{+} \text {att }^{+} \text {trp } E^{+} \text {trp } C^{+}$ ), \right. trp $C$ and $t r p E$ are fully repressed in the presence of tryptophan and are fully expressed in the absence of tryptophan.] $R=$ repressor gene; $R^{n}$ product cannot bind tryptophan; $R^{-}$ product cannot bind operator $o=$ operator for the $t r p$ operon; $o^{-}$ cannot bind repressor $a t t=$ attenuator; $a t t^{-}$ is a deletion of the attenuator $P=$ promoter; $P^{-}$ is a deletion of the $t r p$ operon promoter $t r p E^{-}$ and $t r p C^{-}$ are null (loss-of-function) mutations
a. $R^{+} P^{-} o^{+}$ att $^{+}$ trp $E^{+}$ trp $C^{+}$
b. $R^{-} P^{+} o^{+}$ att $^{+}$ trp $E^{+}$ trp $C^{+}$
c. $R^{n} P^{+} o^{+}$ att $^{+}$ trp $E^{+}$ trp $C^{+}$
d. $R^{-} P^{+} o^{+}$ att $^{-}$ trp $E^{+}$ trp $C^{+}$
e. $R^{+} P^{+} o^{-}$ att $^{+}$ trp $E^{+}$ trp $C^{-} / R^{-} P^{+} o^{+}$ att $^{+}$ $\operatorname{trp} E^{-} \operatorname{trp} C^{+}$
f. $R^{+} P^{-} o^{+}$ att $^{+} \operatorname{tr} p E^{+} \operatorname{tr} p C^{-} / R^{-} P^{+} o^{+} a t t^{+}$
$\operatorname{trp} E^{-} \operatorname{trp} C^{+}$
g. $R^{+} P^{+} o^{-}$ att $^{-}$ trp $E^{+}$ trp $C^{-} / R^{-} P^{+} o^{-}$ att $^{+}$ $\operatorname{trp} E^{-} \operatorname{trp} C^{+}$

James Kiss
James Kiss
Numerade Educator
06:13

Problem 29

One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairing with the ribosome binding site on the sense mRNA to block translation. In a second, alternative mechanism, the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing the sense promoter for the same gene. Design an experimental approach that would enable you to distinguish between these two modes of action at a specific gene. (Hint: What would be the outcome in each case if high levels of the antisense RNA were transcribed from a gene on a plasmid?)

Jennifer Stoner
Jennifer Stoner
Numerade Educator
03:33

Problem 30

For each element in the list that follows, indicate what kind of molecule it is (DNA, RNA, protein, small molecule $),$ whether it acts as a positive or negative regulator, what stage of gene expression it affects, and whether it acts in cis or in trans. (In its most general sense, the term cis describes elements that affect the function of the molecule of which it is a part, while trans describes elements on one molecule that affect
the function of a different molecule.)
a. Lac repressor
b. lac operator
c. CRP
d. CRP-binding site
e. Trp repressor
f. charged tRNA Tre (in terms of its function at the trp operon )
g. the antiterminator at the $t r p$ operon
h. a terminator in the expression platform of a riboswitch
i. an sRNA that blocks mRNA translation

Marisa A
Marisa A
Numerade Educator
View

Problem 31

Among the structurally simplest riboswitches are the two so-called purine riboswitches, one of which responds to guanine, and the other to adenine. The accompanying diagram shows a guanine riboswitch. Base-pairing between free guanine and a particular cytosine residue within the aptamer determines the riboswitch conformation.
a. What condition in the cellular environment would favor each of the riboswitch configurations?
b. In $B$. subtilis, guanine riboswitches are located in 5 different transcription units containing 17 different genes. Based on the diagram and your answer to part (a), what biological processes do you think these 17 genes might be involved in? Explain your reasoning.

Rashmi Sinha
Rashmi Sinha
Numerade Educator
04:59

Problem 32

Great variation exists in the mechanisms by which RNAs can mediate gene regulation. In one recently discovered example shown in the following diagram, the genes $C s r A$ and $C s r B$ are global regulators of suites of target genes that are involved in the use of carbon atoms. The product of $C s r A$ is the CsrA protein, which binds to the ribosome binding site (RBS) of target gene mRNA, preventing target gene expression. The product of the $C s r B$ gene is the CsrB $\mathrm{RNA}$ which contains 22 binding sites for CsrA protein. CsrB RNA can thus compete with target mRNAs for CsrA protein binding. In the presence of high CsrB RNA concentrations, CsrA protein cannot bind to mRNA binding sites, so expression of the target genes is turned on.
a. For the $C s r A$ and $C s r B$ genes, indicate what kind of molecule the gene product is (DNA, RNA, protein, small molecule), whether it acts as a positive or negative regulator, what stage of gene expression it affects, and whether it acts in cis or in trans. (It will be interesting to compare your answers to those for Problem $30 .$ )
b. CsrA/CsrB regulate glycogen biosynthesis and breakdown; glycogen is a polymer of glucose and a major source of stored energy in the human body. CsrA/CsrB are negative regulators of glycogen biosynthesis and positive regulators of glycogen breakdown. To what environmental factor do you think that the CsrA/CsrB system is most likely to respond? Suggest a possible way that this system might be repressible, and then suggest a different hypothesis for how this system might be inducible. (Assume in both cases that CsrB expression is modulated.) Which of your hypotheses would be most consistent with the target genes being involved in glycogen biosynthesis (an anabolic pathway), and which is most consistent with glycogen breakdown (a catabolic pathway)? Explain.

Sana Riaz
Sana Riaz
Numerade Educator
02:49

Problem 33

Many genes whose expression is turned on by DNA damage have been isolated. Loss-of-function mutations in the $l e x A$ gene lead to the expression of many of these genes, even when there has been no DNA damage. Would you hypothesize that LexA protein is a positive or a negative regulator? Why?

Jennifer Stoner
Jennifer Stoner
Numerade Educator
02:05

Problem 34

In $2005,$ Frederick Blattner and his colleagues found that $E .$ coli cells have a global transcriptional program that helps them forage for better sources of carbon. Many genes, including genes needed for bacterial motility, are turned on in response to poorer carbon sources so that the bacteria can search for better nutrition. You now want to search for genes that regulate this response. How could you use $\operatorname{lac} Z$ fusions to try to identify such regulatory genes?

James Kiss
James Kiss
Numerade Educator
04:46

Problem 35

The $E .$ coli MalT protein is a positive regulator of several mal operons, which are induced in the presence of the sugar maltose. The gene that encodes MalT was identified in a screen for mutants causing constitutive expression of $m a l$ operons; the operons were transcribed even in the absence of maltose. The screen involved a lac $Z$ transcriptional fusion reporter gene in which the regulatory region of a maltose-inducible operon was fused to the coding sequences of $\operatorname{lac} Z$
a. Bacteria with a $\operatorname{lac} Z$ - mutation are transformed with the reporter gene and spread on petri plates containing the $\beta$ -galactosidase substrate X-gal. What color would the colonies be if the plates also contained maltose? What if the plates had X-gal but no maltose?
b. In the screen, scientists mutagenized the $\operatorname{lac} Z$ bacteria before transforming them with the reporter gene, and then spread the transformed bacteria on plates with X-gal and no maltose. All of the colonies were white except for one colony that was blue. At this stage of the analysis, researchers could not establish whether the gene mutant in the blue colony encoded a positive or a negative regulator of mal operons.
Suppose first that the gene encoded a positive regulator.
(i) How could the wild-type protein respond to maltose?
(ii) How would the mutation affect protein function? (iii) Describe the likely nature of the mutation in the gene at the molecular level. Now answer these same three questions for the hypothesis in which the gene encoded a negative regulator (a repressor) of mal operon expression.
c. How do you think the scientists figured out that MalT was a positive regulator and not a repressor? (Hint:
Recall Fig. $14.28 .$ Think about what would happen in each case if the researchers attempted to identify the malT mutant using a plasmid library made from the genome of a wild-type strain versus a plasmid library made from the genome of the mutant strain.)

James Kiss
James Kiss
Numerade Educator
02:24

Problem 36

Erythropoietin is a human protein hormone that stimulates the production of red blood cells. Imagine that you are a researcher for a pharmaceutical company, and you want to make this hormone in bacteria so it can be used to treat patients with anemias. You will create a recombinant DNA molecule that has the following elements, some of whose importance will be explained later in the problem:
(i) Coding sequences for human erythropoeitin. (ii) Regulatory sequences of the lac operon. (iii) Sequences encoding the $E$. coli maltose binding protein (MBP). (iv) Sequences encoding a series of five amino acids (DDDDK in the one-letter code $) .$ The pharmaceutical company's engineers will transform a recombinant plasmid with these sequences into $E .$ coli and induce the expression of a tagged fusion protein $\mathrm{N}$ MBP-DDDDKerythropoietin C.
a. Diagram the recombinant plasmid, indicating the order of these four components and how they are arranged with respect to the plasmid vector.
b. Which one of the four elements encodes the ribosome binding site for the mRNA that could make this fusion protein?
c. Which of these four elements must be placed in the same reading frame with respect to each other?
d. Would you obtain the erythropoietin coding sequences from a human genomic DNA clone or from a human cDNA clone? Explain.
e. What compound would you use to induce expression of the fusion protein? Would it be best to add this compound to the medium before you seeded it with $E .$ coli cells, or after the population of cells had grown to high density? Explain.
f. Cells that express the fusion protein also contain many other $E$. coli proteins. For pharmaceutical use, it is important to purify drugs away from contaminants. Given that MBP binds tightly to the sugar maltose, and that maltose can be attached to an insoluble resin, explain how you would purify the fusion protein away from all other $E .$ coli proteins.
g. For pharmaceutical use, the human erythropoietin must not be attached to any other amino acid sequences. A protease called enterokinase cleaves proteins just C-terminal to DDDDK. Explain how you would use enterokinase to separate erythropoietin away from the rest of the fusion protein and then to purify the desired pharmaceutical.

Sana Riaz
Sana Riaz
Numerade Educator
04:36

Problem 37

To find genes that are turned on or off in response to changes in osmolarity (the total concentration of solutes in solution), you grow a culture of $E .$ coli in a medium with high osmolarity and another culture in a medium with low osmolarity. You now perform RNA-Seq analysis on each culture. It is possible that osmotic changes may induce a general stress response that may be seen with other stresses as well (for example, heat shock). How could you distinguish the genes that might be involved in a general stress response from those that are specific for the osmolarity change? (Note: You will need to grow additional bacterial cultures.)

Jennifer Stoner
Jennifer Stoner
Numerade Educator
03:14

Problem 38

The following questions concern Fig. 16.30 :
a. How many genes are depicted in this figure? How many operons? What is the average gene density in the region shown? Is this value representative of most bacterial genomes?
b. No transcripts at all were detected for the gene $t 2110 .$ Do these data prove the $t 2110$ is nonfunctional? If no transcripts of the gene were found, how could scientists assign a direction to its transcription?
c. What kind of evidence in the figure would suggest the existence of an attenuation or riboswitch mechanism that causes premature transcriptional termination of an operon? Under the environmental conditions analyzed, do any of these operons appear to be controlled by such a mechanism?
d. The data shown in Fig. 16.30 do not provide any evidence that any of the genes or operons depicted are regulated by an antisense transcript. What would the data look like if an antisense mechanism was involved in controlling a gene or operon?
e. Although the galM gene is depicted as part of the operon that contains $g$ al $E T K$, it is possible that galM is actually transcribed from a separate pro-
moter. What evidence in the figure suggests this possibility?
f. Could the data shown in Fig. 16.30 reveal the existence of a regulatory mechanism in which an sRNA occludes a ribosome binding site?

Jessica Wooten
Jessica Wooten
Numerade Educator
View

Problem 39

In many bacterial species, regulatory sRNAs have been identified by transcriptome sequencing (RNASeq). How do researchers know that the small RNA species identified by cDNA sequencing are regulatory sRNAs rather than fragments of longer mRNAs?

Rashmi Sinha
Rashmi Sinha
Numerade Educator
04:59

Problem 40

Many bacterial genes involved in amino acid biosynthesis are regulated by RNA leaders that respond, indirectly, to the level of a specific amino acid. Like attenuators or some riboswitches, these allosteric RNA leaders, called $T$ -box leaders, can form either terminators or antiterminators. The name $T$ -box refers to a 14 -nucleotide sequence present in all of these RNA leaders; a $5^{\prime}$ UGGU $3^{\prime}$ sequence within the T-box is complementary to the conserved $3^{\prime}$ end of tRNAs $\left(5^{\prime} \text { ACCA } 3^{\prime}\right)$

The first T-box RNA device was discovered in the $B$. subtilis tyrS gene, which encodes tyrosyl-tRNA synthetase, the enzyme that charges tRNA $^{\text {Tyr }}$ with tyrosine. As shown in the following diagram, the T-box leader can bind to the anticodon, and at the same time, to the $3^{\prime}$ end of the same uncharged tRNA $^{\text {Tyr }}(\text { left })$. When uncharged tRNA $^{\text {Tyr is bound, an }}$ antiterminator forms in the leader; otherwise, a terminator forms (right).
a. Most of the tRNA synthetase genes in $B$. subtilis are regulated by T-box RNA leaders that respond to specific uncharged tRNAs. Explain the logic of this regulation.
b. How could you alter the base sequence of the
B. subtilis tyrS T-box leader so that it might respond to uncharged tRNA $^{\text {Phe instead of uncharged t} R N A^{\text {Tyr }} \text { ? }}$
c. The T-box is responsible for nearly all of the regulation of tyrS gene expression. What do you predict would happen to tyrS gene expression if the the $5^{\prime}$ UAC $3^{\prime}$ in the RNA leader that interacts with the tRNA $^{\text {Tyr anticodon was changed to to } 5^{\prime} \text { CUA } 3^{\prime} ?}$ Explain.
L. Key experimental support for the idea that the T-box RNA leader binds tRNAs was the finding that normal function could be restored to the mutant T-box described in part (c) by a particular mutation in a gene different from tyrS. What specific bacterial gene mutation would render the mutant T-box RNA leader functional again?
Results of experiments involving a tyrS-lacZ reporter gene indicated that the $t y r S$ T-box leader responds directly to relative levels of charged versus uncharged tRNAs rather than to the availability of tyrosine. These experiments involved expression of mutant tRNA $^{\text {Tyr }}$ species. These mutations were outside of the anticodon or the four base pairs at the $3^{\prime}$ end, yet they prevented the tRNA from being charged by tRNA synthetase.
e. An otherwise wild-type $B$. subtilis strain contains a tyrS -lacZ reporter transgene that includes the
T-box RNA leader. Compare the expression of $\beta$ -galactosidase in this strain when tyrosine levels are low as opposed to when tyrosine levels are high.
f. Suppose now that the $t R N A^{T y r}$ gene in the strain described in part (e) was replaced with the mutant $t R N A^{T y r}$ gene described earlier with mutations that prevented the tRNA from being charged. Compare the expression of $\beta$ -galactosidase in this new strain when tyrosine levels are low as opposed to when tyrosine levels are high. Explain how this experiment distinguished the two hypotheses.
g. T-box regulators have been identified in many other bacterial species using computer algorithms. What do you think the computer programs searched for?

Sana Riaz
Sana Riaz
Numerade Educator
02:24

Problem 41

Describe how RNA-Seq analysis could have been used to discover the components of the $V$. fischeri quorum-sensing pathway. Would any of the components of the pathway shown in Fig. 16.33 have escaped detection? Explain.

James Kiss
James Kiss
Numerade Educator
04:46

Problem 42

The researchers who investigated bioluminescence and quorum sensing found that $E .$ coli transformed with a plasmid containing a $9 \mathrm{kb}$ fragment of $V$. fischeri DNA could glow when the cell population was
dense. They mutagenized these $E$. coli cells and isolated many mutations that mapped to the 9 kb fragment and prevented the cells from glowing. They then performed complementation testing on these mutants by transforming $E .$ coli cells simultaneously with two plasmids, each containing the 9 kb fragment with one of the mutations. To ensure the $E$. coli cells were transformed with both plasmids, one of the two plasmids had a gene conferring resistance to ampicillin, while the other plasmid had a gene conferring resistance to tetracycline, and cells were selected on petri plates that had both antibiotics.
a. Construct a $9 \times 9$ complementation table for the nine mutations list that follows, using + to indicate cells that would glow and - to indicate cells that would remain dark. (You only need to fill in half the table.)
Mutation 1: Encodes a LuxA protein that cannot bind a substrate for the luciferase enzyme
. Mutation 2: Encodes a LuxA protein that cannot associate with the LuxB protein
Mutation 3: Encodes a LuxB protein that cannot associate with the LuxA protein Mutation 4: A null mutation in the luxI gene
Mutation 5: Encodes a LuxR protein that cannot bind DNA
. Mutation 6: Encodes a LuxR protein that cannot bind to the autoinducer
Mutation 7: A mutation in the $l u x R$ promoter that prevents transcription

Mutation 8: A mutation in the $l u x I C D A B E$ promoter that prevents transcription
Mutation $9: A$ mutation in the $l u x I C D A B E$ promoter region that blocks binding of the LuxR protein
b. How many complementation groups exist among these nine mutations??
c. Is your answer to part
(b) also the number of different genes? Explain.

James Kiss
James Kiss
Numerade Educator
05:16

Problem 43

A key experiment in understanding the molecular mechanism of quorum sensing involved the use of two transcriptional fusion reporter genes, each made within the $9 \mathrm{kb}$ fragment of $V$. fischeri DNA described in Problem $42 .$ In one reporter $(\text {luxR} \text {lac } Z$ ), the $l u x R$ regulatory region drives $\operatorname{lac} Z$ transcription (that is, the $l u x R$ coding sequences are replaced by those of $\operatorname{lac} Z$ ). In the other reporter ( luxICDABE llacZ ), the $l u x I C D A B E$ operon regulatory sequences drive lac $Z$ expression (that is, the operon structural genes are replaced by $\operatorname{lac} Z \text { coding sequences }) .$ Fig. 16.33 shows the structure of the $l u x R$ and $l u x I C D A B E$ region of $V$. fischeri. E. coli colonies (chromosomally $\operatorname{lac} Z$ ) containing either reporter ( lux R lac $Z$ or $l$ ux ICDABE / IacZ were white. When purified autoinducer molecules were added to the media, the $\operatorname{lu} x R$ / lacZ colonies remained white, but the $\operatorname{luxICDABE}$ lac $Z$ colonies turned blue over time.
a. Explain why luxR lac $Z$ colonies were white in the absence of the autoinducer.
b. Explain why luxICDABE/lacZ were white in the absence of the autoinducer.
c. Explain why $l u x R / l a c Z$ colonies remained white in the presence of the autoinducer.
d. Explain why luxICDABE llacZ colonies turned blue in the presence of the autoinducer, and why this reaction was time-dependent.
e. What do these results suggest about the transcription of the luxR gene?

Sana Riaz
Sana Riaz
Numerade Educator
04:32

Problem 44

Quorum sensing controls the expression of virulence in many pathogenic bacteria. Usually, pathogens express toxins in response to receptor activation by ligand binding at high cell density. $V$. cholerae (the causative agent of cholera) does the opposite; its virulence genes are expressed only at low cell density because its quorum-sensing receptor is repressed by ligand binding. The unusual "reversed" mechanism for activating virulence genes in $V$. cholerae has suggested to scientists a simple idea for generating a new kind of antibiotic for the treatment of cholera. Explain.

Jennifer Stoner
Jennifer Stoner
Numerade Educator
02:20

Problem 45

Scientists are currently screening a chemical library of small molecules for inhibitors of bioluminescence in response to high cell density in $V$. fischeri. The small molecules were chosen for their potential ability to bind LuxR.
a. How could a molecule that binds LuxR prevent bioluminescence?
b. Hundreds of different bacterial species use quorum sensing mechanisms similar to that of $V$. fischeri and encode proteins similar to LuxI and LuxR. In light of this information, why do you think scientists want to identify the molecule described in part (a)?

James Kiss
James Kiss
Numerade Educator