Genetics: A Conceptual Approach

Benjamin Pierce

Chapter 15

The Genetic Code and Translation - all with Video Answers

Educators

Chapter Questions

Problem 1

What is the one gene, one enzyme hypothesis? Why was this hypothesis an important advance in our understanding of genetics?

Eric Goldman

Eric Goldman

Numerade Educator

Problem 2

What different methods were used to help break the genetic code? What did each method reveal and what were the advantages and disadvantages of each one?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 3

What are isoaccepting tRNAs?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 4

What is the significance of the fact that many synonymous codons differ only in the third nucleotide position?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 5

Define the following terms as they apply to the genetic code:
a. Reading frame
b. Overlapping code
c. Nonoverlapping code
d. Initiation codon
e. Termination codon
f. Sense codon
g. Nonsense codon
h. Universal code
i. Nonuniversal codons
6. How is the reading frame of a nucleotide sequence set?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 6

How is the reading frame of a nucleotide sequence set?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 7

How are tRNAs linked to their corresponding amino acids?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 8

What role do the initiation factors play in protein synthesis?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 9

How does the process of initiation differ in bacterial and eukaryotic cells?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 10

Give the elongation factors used in bacterial translation and explain the role played by each factor in translation.

Khalida Dawar

Numerade Educator

Problem 11

What events bring about the termination of translation?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 12

Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells, giving similarities and differences in the process of translation in these two types of cells.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 13

How do prokaryotic cells overcome the problem of a stalled ribosome on an mRNA that has no termination codon? How do eukaryotic cells solve this problem?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 14

What are some types of posttranslational modification of proteins?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 15

Explain how some antibiotics work by affecting the process of protein synthesis.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 16

Sydney Brenner isolated Salmonella typhimurium mutants that were implicated in the biosynthesis of tryptophan and would not grow on minimal medium. When these bacterial mutants were tested on minimal medium to which one of four compounds (indole glycerol phosphate, indole, anthranilic acid, and tryptophan) had been added, the growth responses shown in the following table were obtained.
(TABLE CANNOT COPY)
Give the order of indole glycerol phosphate, indole, anthranilic acid, and tryptophan in a biochemical pathway leading to the synthesis of tryptophan. Indicate which step in the pathway is affected by each of the

Khalida Dawar

Numerade Educator

Problem 17

Compounds I, II, and III are in the following biochemical pathway:
(FIGURE CANNOT COPY)
Mutation $a$ inactivates enzyme $\mathrm{A}$, mutation $b$ inactivates enzyme $\mathrm{B}$, and mutation $c$ inactivates enzyme $\mathrm{C}$. Mutants, each having one of these defects, were tested on minimal medium to which compound I, II, or III was added. Fill in the results expected of these tests by placing a plus $\operatorname{sign}(+)$ for growth or a minus $\operatorname{sign}(-)$ for no growth in the table below.
(EQUATION CANNOT COPY)

Khalida Dawar

Numerade Educator

Problem 18

A geneticist conducts the experiment outlined in Figure $15.8,$ but this time she combines guanine nucleotides (instead of uracil) with polynucleotide phosphorylase. Radioactively labeled protein should appear in which tube?

Khalida Dawar

Numerade Educator

Problem 19

For the experiment outlined in Figure $15.8,$ could Nirenberg and Matthaei have substituted RNA polymerase instead of polynucleotide phosphorylase without otherwise modifying the experiment? Why or why not?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 20

Assume that the number of different types of bases in RNA is four. What would be the minimum codon size (number of nucleotides) required to specify all amino acids if the number of different types of amino acids in proteins were (a) $2,$ (b) $8,(\mathrm{c}) 17,$ (d) $45,$ (e) $75 ?$

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 21

How many codons would be possible in a triplet code if only three bases
$(\mathrm{A}, \mathrm{C},$ and U) were used?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 22

Referring to the genetic code presented in Figure $15.10,$ give the amino acids specified by the following bacterial mRNA sequences.
a. $5^{\prime}-$ AUGUUUAAAUUUAAAUUUUGA-3'
b. $5^{\prime}-$ AGGGAAAUCAGAUGUAUAUAUAUAUAUGA-3'
c. $5^{\prime}-$ UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA-3'
d. $5^{\prime}-$ GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA-3'

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 23

A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence?
5'-ATGATACTAAGGCCC-3'

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 24

The following amino acid sequence is found in a tripeptide: Met-TrpHis. Give all possible nucleotide sequences on the mRNA, on the template strand of DNA, and on the nontemplate strand of DNA that can encode this tripeptide.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 25

How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence Met-Leu-Arg? (Be sure to include the stop codon.)

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 26

A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table 15.2 and give all possible codons with which each tRNA can pair.
a. $5^{\prime}-G G C-3^{\prime}$
b. $5^{\prime}-A A G-3^{\prime}$
c. $5^{\prime}-$ IAA $-3^{\prime}$
d. $5^{\prime}-U G G-3^{\prime}$
$3.5^{\prime}$ 2

Khalida Dawar

Numerade Educator

Problem 27

A researcher creates random copolymers of three nucleotides each by mixing polynucleotide phosphorylase with guanine and adenine nucleotides in a ratio of 5 guanine nucleotides to 1 adenine. Give the different copolymers produced and their theoretical proportions.

John Koskinen

Numerade Educator

Problem 28

Assume that the nucleotide at the $5^{\prime}$ end of the first tRNA's anticodon (the tRNA on the left) in Figure 15.11 was mutated from $G$ to U. Give all codons with which the new, mutated anticodon could pair.

Khalida Dawar

Numerade Educator

Problem 29

Which of the following amino acid changes could result from a mutation
that changed a single base? For each change that could result from the alteration of a single base, determine which position of the codon (first, second, or third nucleotide) in the mRNA must be altered for the change to result.
a. Leu $\rightarrow$ Gln
b. Phe $\rightarrow$ Ser
c. Phe $\rightarrow$ Ile
d. $\mathrm{Pro} \rightarrow$ Ala
e. $A s n \rightarrow$ Lys
f. Ile $\rightarrow$ Asn

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 30

Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis:
70S initiation complex
$30 \mathrm{S}$ initiation complex release factor 1 elongation factor G initiation factor 3 elongation factor Tu
fMet-tRNA fMet

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 31

Examine the tRNA in Figure 15.14. What do you think would be the potential effect of a mutation in the part of the tRNA gene that encodes
(a) the acceptor stem; (b) the anticodon; (c) one of the red nucleotide positions?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 32

The following diagram illustrates a step in the process of translation. Identify the following elements on the diagram.

Danielle Ashley

Danielle Ashley

Numerade Educator

Problem 33

Refer to the diagram in Problem 32 to answer the following questions.
a. What will be the anticodon of the next tRNA added to the A site of the ribosome?
b. What will be the next amino acid added to the growing polypeptide chain?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 34

A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following components were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning a. Initiation factor 3
b. Initiation factor 2
c. Elongation factor Tu
d. Elongation factor $\mathbf{G}$
e. Release factors RF-1, RF-2, and RF-3
f. ATP
g. GTP

Alexander Cheng

Alexander Cheng

Numerade Educator

Problem 35

For each of the following sequences, place a check mark in the appropriate space to indicate the process most immediately affected by deleting the sequence. Choose only one process for each sequence (i.e., one check mark per sequence).
(TABLE CANNOT COPY)

Rabeya Zahid

Numerade Educator

Problem 36

MicroRNAs are small RNA molecules that bind to the 3' end of mRNA and suppress translation (see Section 14.5). Some eukaryotic mRNAs have internal ribosome-binding sites downstream of the $5^{\prime}$ cap, where ribosomes normally bind. In one investigation, miRNAs did not suppress translation by ribosomes that had attached to internal ribosomebinding sites (R. S. Pillai et al. 2005. Science 309:1573-1576). What does this finding suggest about how miRNAs suppress translation?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 37

Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 38

Mutations that introduce stop codons cause a number of genetic diseases. For example, from $2 \%$ to $5 \%$ of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTR that is nonfunctional and results in the symptoms of cystic fibrosis (see Section 5.1 ). One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome's ability to correctly read stop codons (C. Ainsworth. 2005. Nature 438:726-728). On the basis of what you know about the mechanism of nonsense-mediated mRNA decay (NMD), would you expect NMD to pose a problem for this type of treatment? Why or why not?
(IMAGE CANNOT COPY)

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 39

The redundancy of the genetic code means that some amino acids are specified by more than one codon. For example, the amino acid leucine is specified by six different codons. Within a genome, synonymous codons are not present in equal numbers; some synonymous codons appear much more frequently than others, and the preferred codons differ among species. For example, in one species, the codon UUA might be used most often to specify leucine, whereas in another species, the codon CUU might be used most often. Speculate on a reason for this bias in codon usage and why the preferred codons are not the same in all organisms.

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 40

In what ways are spliceosomes and ribosomes similar? In what ways are they different? Can you suggest some possible reasons for their similarities?

Sam Limsuwannarot

Sam Limsuwannarot

Numerade Educator

Problem 41

Several experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNA $_{\text {iMet }}$ ) was located and changed; specifically, the nucleotides that specify the anticodon on tRNA $_{\mathrm{i}}^{\text {Met }}$ were mutated so that the anticodon in the tRNA was $5^{\prime}-$ CCA- $3^{\prime}$ instead of $5^{\prime}-$ CAU- $3^{\prime} .$ When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal.
a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.
b. If the same experiment had been conducted on bacterial cells, what results would you expect?
c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal.

Tom Comey

Numerade Educator