• Home
  • Textbooks
  • Molecular Biology
  • The Mechanism of Transcription in Bacteria

Molecular Biology

Robert F. Weaver

Chapter 6

The Mechanism of Transcription in Bacteria - all with Video Answers

Educators

Chapter Questions

01:12

Problem 1

Explain the following findings: (1) Core RNA polymerase transcribes intact T4 phage DNA only weakly, whereas holoenzyme transcribes this template very well; but (2) core polymerase can transcribe calf thymus DNA about as well as the holoenzyme can.

Rashmi Sinha
Rashmi Sinha
Numerade Educator
01:26

Problem 1

Draw the structure of an RNA hairpin with a 10 -bp stem and a 5 -nt loop. Make up a sequence that will form such a structure. Show the sequence in the linear as well as the hairpin form.

Mikayla Stephens
Mikayla Stephens
Numerade Educator

Problem 2

How did Bautz and colleagues show that the holoenzyme transcribes phage T4 DNA asymmetrically, but the core transcribes this DNA symmetrically?

Check back soon!
01:29

Problem 2

An E. coli promoter recognized by the RNA polymerase holoenzyme containing $\sigma^{70}$ has $a-10$ box with the following sequence in the nontemplate strand: $5^{\prime}$-CATAGT-3'. (a) Would a $\mathrm{C} \rightarrow \mathrm{T}$ mutation in the first position likely be an up or a down mutation? (b) Would a $\mathrm{T} \rightarrow \mathrm{A}$ mutation in the last position likely be an up or down mutation? Explain your answers.

Mikayla Stephens
Mikayla Stephens
Numerade Educator
03:00

Problem 3

Describe an experiment to measure the dissociation rate of the tightest complex between a protein and a DNA. Show sample results of weak and tight binding. How do these results relate to the binding of core polymerase and holoenzyme to DNA that contains promoters?

Sana Riaz
Sana Riaz
Numerade Educator
04:41

Problem 3

You are carrying out experiments to study transcription termination in an Ecoli gene. You sequence the $3^{\prime}$-end of the gene and get the following results:
$5^{\prime}$ - CGAAGCGCCGATTGCCGGCGCTTTTTTTT - $3^{\prime}$
$3^{\prime}$ - GCTTCGCGGCTAACGGCCGCGAAAAAAAAA - ' $^{\prime}$
You then create mutant genes with this sequence changed to the following (top, or nontemplate strand, $5^{\prime} \rightarrow 3^{\prime}$ ):
Mutant A: CGAAACTAAGATTGCAGCAGTTITTTTT
Mutant B: CGAAGCGCCGTAGCACGGCGCTITTTTTT
Mutant C: CGAAGCGCCGATTGCCGGCGCTTACGGCCC
You put each of the mutant genes into an assay that measures termination and get the following results:
(TABLE CAN'T COPY)
a. Draw the structure of the RNA molecule that results from transcription of the wild-type sequence above.
b. Explain these experimental results as completely as possible.

Meryl Strobel
Meryl Strobel
Numerade Educator
02:49

Problem 4

Examine the sequences below and determine the consensus sequence.
TAGGACT - TCGCAGA - AAGCTTG - TACCAAG TTCCTCG

Alexander Clippinger
Alexander Clippinger
Numerade Educator
04:48

Problem 4

What effect does temperature have on the dissociation rate of polymerase-promoter complexes? What does this suggest about the nature of the complex?

Salman Saeed
Salman Saeed
Numerade Educator
02:25

Problem 5

Diagram the difference between a closed and an open promoter complex.

Sana Riaz
Sana Riaz
Numerade Educator
04:31

Problem 6

Diagram a typical prokaryotic promoter, and a promoter with an UP element. Exact sequences are not necessary.

Eric Tran
Eric Tran
Numerade Educator

Problem 7

Describe and give the results of an experiment that demonstrates the formation of abortive transcripts by E. coli RNA polymerase.

Check back soon!
03:34

Problem 8

Diagram the four-step transcription initiation process in E. coli.

Dennis Howard
Dennis Howard
Numerade Educator

Problem 9

Describe and show the results of an experiment that measures the effects of $\sigma$ on transcription initiation and elongation rates.

Check back soon!

Problem 10

How can you show that $\sigma$ does not really accelerate the rate of transcription elongation?

Check back soon!
01:14

Problem 11

What final conclusion can you draw from the experiments in the previous two questions?

Rachel Vallejo
Rachel Vallejo
Numerade Educator

Problem 12

Describe and show the results of an experiment that demonstrates the reuse of $\sigma$. On the same graph, show the results of an experiment that shows that the core polymerase determines resistance to rifampicin.

Check back soon!

Problem 13

Draw a diagram of the " $\sigma$-cycle," assuming $\sigma$ dissociates from core during elongation.

Check back soon!

Problem 14

Describe and show the results of a fluorescence resonance energy transfer (FRET) experiment that suggests that $\sigma$ does not dissociate from the core polymerase during elongation.

Check back soon!
00:30

Problem 15

In the $\sigma$-cycle, what is obligate release and what is stochastic release? Which is the favored hypothesis?

Sana Riaz
Sana Riaz
Numerade Educator

Problem 16

Propose three hypotheses for the mechanism of abortive transcription in E. coli. Describe and give the results of a FRET experiment that supports one of these hypotheses.

Check back soon!

Problem 17

Describe and show the results of an experiment that shows which base pairs are melted when RNA polymerase binds to a promoter. Explain how this procedure works.

Check back soon!

Problem 18

Describe and show the results of an experiment that gives an estimate of the number of base pairs melted during transcription by E. coli RNA polymerase.

Check back soon!
01:50

Problem 19

What regions of the $\sigma$-factor are thought to be involved in recognizing (1) the -10 box of the promoter and (2) the -35 box of the promoter? Without naming specific residues, describe the genetic evidence for these conclusions.

Alexander Clippinger
Alexander Clippinger
Numerade Educator

Problem 20

Describe a binding assay that provides biochemical evidence for interaction between $\sigma$-region 4.2 and the -35 box of the promoter.

Check back soon!

Problem 21

Cite evidence to support the hypothesis that the $\alpha$-subunit of E. coli RNA polymerase is involved in recognizing a promoter UP element.

Check back soon!
02:05

Problem 22

Describe how limited proteolysis can be used to define the domains of a protein such as the $\alpha$-subunit of E.coli RNA polymerase.

Dennis Howard
Dennis Howard
Numerade Educator
04:47

Problem 23

Describe an experiment to determine which polymerase subunit is responsible for rifampicin and streptolydigin resistance or sensitivity.

Sana Riaz
Sana Riaz
Numerade Educator

Problem 24

Describe and give the results of an experiment that shows that the $\beta$-subunit of $E$. coli RNA polymerase is near the active site that forms phosphodiester bonds.

Check back soon!

Problem 25

Describe an RNA-DNA cross-linking experiment that demonstrates the existence of an RNA-DNA hybrid at least 8 bp long within the transcription elongation complex.

Check back soon!
03:31

Problem 26

Draw a rough sketch of the structure of a bacterial RNA polymerase core based on $x$-ray crystallography. Point out the positions of the subunits of the enzyme, the catalytic center, and the rifampicin-binding site. Based on this structure, propose a mechanism for inhibition of transcription by rifampicin.

Alexander Clippinger
Alexander Clippinger
Numerade Educator
02:18

Problem 27

Based on the crystal structure of the E. coli elongation complex, what factors limit the length of the RNA-DNA hybrid?

Alexander Clippinger
Alexander Clippinger
Numerade Educator
02:46

Problem 28

Based on the crystal structures of the E. coli elongation complex with and without the antibiotic streptolydigin, propose a mechanism for the antibiotic.

Aadit Sharma
Aadit Sharma
Numerade Educator

Problem 29

Draw a rough sketch of the crystal structure of the holoenzyme-DNA complex in the open promoter form. Focus on the interaction between the holoenzyme and DNA. What enzyme subunit plays the biggest role in DNA binding?

Check back soon!

Problem 30

Sigma regions 2.4 and 4.2 are known to interact with the -10 and -35 boxes of the promoter, respectively. What parts of this model are confirmed by the crystal structure of the holoenzyme-DNA complex? Provide explanations for the parts that are not confirmed.

Check back soon!
00:45

Problem 31

Present two models for the way the RNA polymerase can maintain the bubble of melted DNA as it moves along the DNA template. Which of these models is favored by the evidence? Cite the evidence in a sentence or two.

Eleanor Behling
Eleanor Behling
Numerade Educator
04:50

Problem 32

What are the two important elements of an intrinsic transcription terminator? How do we know they are important? (Cite evidence.)

Jennifer Stoner
Jennifer Stoner
Numerade Educator

Problem 33

Present evidence that a hairpin is not required for pausing at an intrinsic terminator.

Check back soon!

Problem 34

Present evidence that base-pairing (of something) with the RNA upstream of a pause site is required for intrinsic termination.

Check back soon!
03:53

Problem 35

What does a rho-dependent terminator look like? What role is rho thought to play in such a terminator?

Cody Delk
Cody Delk
Numerade Educator

Problem 36

How can you show that rho causes a decrease in net RNA synthesis, but no decrease in chain initiation? Describe and show the results of an experiment.

Check back soon!
06:57

Problem 37

Describe and show the results of an experiment that demonstrates the production of shorter transcripts in the presence of rho. This experiment should also show that rho does not simply act as a nuclease.

Sana Riaz
Sana Riaz
Numerade Educator

Problem 38

Describe and show the results of an experiment that demonstrates that rho releases transcripts from the DNA template.

Check back soon!