Questions asked
I want to change the amino acid encoded by the highlighted codon below. If I was using the primer listed in overlap extension PCR, to what amino acid would I be aiming to change it to? ATG GAA CTT CAT TGT CCC AAA GTA CTA CTA TAT CAG GTA TTG Primer: TTGTCCCAAAGGACTACTATATC
PCR stands for?
Jenny Wu
Numerade educator
Do we need reverse transcriptase in PCR reaction?
Jennifer Stoner
Which of the following are essential components of a PCR reaction
What would be the effect on the PCR reaction if any of the following circumstances arose: 1) there are no primers in the reaction, 2) there are no dNTPs in the reaction, 3) there is no Taq polymerase in the reaction? True False
You must immerse the barrel of the micropipette in fluid, when taking in liquid True False
The best tool to measure 146 uL (microliters) ? a. A 20 - 200 uL micropipettor b. PTP (plastic transfer pipette) c. graduated cylinder d. 5 - 50 uL micropipettor