Ace - AI Tutor
Ask Our Educators
Textbooks
My Library
Flashcards
Scribe - AI Notes
Notes & Exams
Download App
john garza

john g.

Divider

Questions asked

BEST MATCH

EC 202 HW 1 - Supply, Demand, GDP, Deflator, GDP Growth (6) EC 202: HW #1 To answer Questions #1-2, use the following information concerning the nominal GDP (in trillions of dollars) for the nation state of Wensleyland in 2018: National Expenditure Consumption = $7.4 National Income Wages and salaries = $5.6; Investment = $2.6 Exports = $1.4 Imports $2.1 Government purchases =$2.0 Corporate Profit and Proprietors Income = $2.2 Rent = $1.0 Interest Income = Certain taxes, depreciation, and statistical discrepancy = $2.4 1. What is the nominal GDP in 2018? 2. What is the nominal value of interest income in 2018? To answer Questions #3-5, use the following table of information. Year Nominal GDP GDP Deflator Real GDP (billions of (billions of $) $) 1 540 98 551 2 600 100 3 700 105 3. What is real GDP in Year 2? 4. What is real GDP in Year 3? 5. Calculate real GDP growth from year 1 to year 2. 6. Country Alpha and Country Beta initially have the same real GDP per capita. Country Alpha experiences no economic growth, while Country Beta grows at a sustained rate of 5 percent. In 14 years, Country Alpha's GDP will be approximately Country Beta. A. one-fourth B. one-half that of

View Answer
divider
BEST MATCH

Function Evaluation, Rule of 4 On the right are four functions, each using one of the function representations we've learned about in this lesson. Use functions, $f(x)$, $g(x)$, $h(x)$ and $p(t)$ to answer the questions on the left. Evaluate $f(5)$ f(5) = $f(x)$ Determine $x$ when $f(x) = 0$ x = Evaluate $g(7)$ g(7) = Determine $x$ when $g(x) = 23$ x = Evaluate $h(-8)$ h(-8) = Determine $x$ when $h(x) = 174$ x = Evaluate $p(23)$ p(23) = Determine $t$ when $p(t) = -5$ t = g(x): \{(-17,23), (-16,67), (-12,35), (-5,-9), (7,40), (23,81), (29,15), (31,7), (44,26), (82,1)} $\begin{array}{|c|c|} \hline t & p(t) \\ \hline -17 & 70 \\ -16 & 23 \\ -12 & 87 \\ -5 & 89 \\ 7 & 35 \\ 23 & 90 \\ 29 & 48 \\ 31 & 49 \\ 44 & -5 \\ 82 & 117 \\ \hline \end{array}$ h(x) = -16x - 2

View Answer
divider
BEST MATCH

Repeat Problem P3.74 with the dot placed at the bottom of L2.

View Answer
divider
BEST MATCH

The current price of a non-dividend paying stock is $50. Use a two-step tree to value a European put option on the stock with a strike price of $50 that expires in 12 months. Each step is 6 months, the risk free rate is 5% per annum, and the volatility is 50%. What is the value of the option according to the two-step binomial model. Please enter your answer rounded to two decimal places (and no dollar sign)

View Answer
divider
BEST MATCH

Figure 2 shows a nucleotide sequence alignment of the RdRp, E, and N gene regions that span the designed real-time RT-PCR primers, for a number of SARS-CoV-2 and bat CoV sequences. Looking at the RdRp sequence primer regions, which CoV sequence is most different to the SARS-CoV-2 and why? (up to 50 words). FIGURE 2 Partial alignments of oligonucleotide binding regions, SARS-related coronaviruses (n = 9) RdRp_SARSr- A. RdRp gene RdRp_SARSr-F P1: RdRp_SARSr-R ...R................. P2:..... WH-Human_1|China|2019-Dec GTGAAATGGTCATGTGTGGCGG CCAGGTGGAACCTCATCAGGAGATGC BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoV/Wuhan/IVDC-HB-04/2020|EPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_ISL_402124 MG772933 Bat SARS-related CoV (bat-SL-CoVZC45) NC_004718 Human SARS-related CoV (e.g. Frankfurt-1 NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008) TATGCTAATAGTGTTTTTAACATTTG E_Sarbeco_F B. E gene WH-Human_1|China|2019-Dec ACAGGTACGT TAATAGT TAATAGCGT BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoV/Wuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoV/Wuhan/IVDC-HB-04/2020jEPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_ISL_402124 MG772933 Bat SARS-related CoV (bat-SL-CoVZC45) NC_004718 Human SARS-related CoV (e.g. Frankfurt-1) NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008 E_Sarbeco_P1 E_Sarbeco_R ACA TGCGTACTGCTGCAATAT N_Sarbeco_F N_Sarbeco_P N_Sarbeco_R C.N gene WH-Human_1|China|2019-Dec BetaCoV/Wuhan/IPBCAMS-WH-01/2019|EPI_ISL_402123 BetaCoVMuhan/IVDC-HB-01/2019|EPI_ISL_402119 BetaCoVMuhan/IVDC-HB-04/2020|EPI_ISL_402120 BetaCoV/Wuhan/IVDC-HB-05/2019|EPI_ISL_402121 BetaCoV/Wuhan/WIV04/2019|EPI_iSL_402124 MG772933 Bat SARSrelated CoV(bat-SL-CoVZC45 NC_004718 Human SARS-related CoV (e.g. Frankfurt-1) NC_014470 Bat SARS-related CoV (BM48-31/BGR/2008) ....... .... CACATTGGCACCCGCAATC ACTTCCTCAAGGAACAACATTGCCA CAAGCCTCTTCTCGTTCCTC TAA which can be used as a positive control for all three RT-PCR assays. The alignment also contains a closely related bat virus (Bat SARS-related clade, detected in Bulgaria (GenBank accession number NC_o1447o). Dots represent identical nucleotides compared with the WH_Human_1 sequence. Nucleotide substitutions are specified. Blue arrows: oligonucleotides as specified in Table 1. More comprehensive alignments can be found in the Supplement.

View Answer
divider
BEST MATCH

13. Joint moment generating function. For each of the following joint density functions of the pair (X, Y), find the joint moment generating function $M(s, t) = E(e^{sX+tY})$, and hence find $cov(X, Y)$. (a) We have that $f(x, y) = 2e^{-x-y}$ for $0 < x < y < \infty$. (b) We have that $f(x, y) = \frac{x^2 + y^2 + c^2}{2\pi(2 + c^2)} \exp\{-\frac{1}{2}(x^2 + y^2)\}$, $x, y \in \mathbb{R}$.

View Answer
divider
BEST MATCH

C. Active transport D. Endocytosis 15. The hormone that is pn: A. Pepsin B. Gastrin C. Cholecystokinin D. Ghrelin 16. What functions do carbohydrates perform in the body? Select all that apply: A. Provide energy B. Spare protein C. Prevent Ketosis D. Induce ketosis 17. Adam needs to eat approximately 4,000 kilocalories (kcals) daily to maintain his current weight. How many carbohydrates should Adam eat each day to meet the AMDR? A. Between 1,800-2,600 (KCALS) B. Between 1,200-2,600 kcals C. Between 1,600-2,600 kcals D. Between 2,000-3,000 kcals 18. How many grams of carbohydrates should I consume if it should be 45-65 percent of my total kilocalories? A. 450-650 grams B. 340-550 grams C. 600-780 grams D. 260-500 grams Write briefly about the following: 19. What is glycemic index and glycemic load? 20. How can you use both glycemic index and glycemic load in meal planning?

View Answer
divider
BEST MATCH

When there's a margin call, one needs to restore the maintenance margin requirement. O True O False

View Answer
divider
BEST MATCH

______________1. Determine the property described by units of kJ/kg.K. ______________2. Reynolds number is an important dimensionless quantity used in transport phenomena. This number is expressed by the equation Dνρ/µ, where D is the diameter of the conduit, ν is the fluid velocity and ρ is mass density. Determine the base units of absolute viscosity in American Engineering System. ______________3. British thermal unit (Btu) is a defined unit of energy. Give the equivalent unit of Btu in SI base units. ______________4. Give the time in millisecond equivalent to 1,000 nanoseconds. ______________5. Power is commonly expressed by the derived unit Watt (W). Give the SI base units equivalent to W.

View Answer
divider
BEST MATCH

Suppose a single-crystal Si wafer has lateral dimensions of 1 cm x 1 cm and is microfabricated to create 64 Mbytes of transistors on it (recall 1 byte = 8 bits). Estimate the lateral size of a single transistor on this chip.

View Answer
divider