Numerade

Questions asked

BEST MATCH

Below is a partial mRNA sequence. Use it to answer the following questions. 5' - UGGUCGGCGAGAACGAAAGCGC - 3^(') Suppose the frameshift mutation was still present, but now there was a base substitution ( A to C ) in the arginine (R) codon, changing it from AGA to AGC. Original Sequence: 5^(')- UG || GUC || GGC || GAG || AAC || GAA |AGC | GC - 3^(') Mutated Sequence: 5^(')- UG || GUC || GGG |AGC || ACG || AAA | GCG | C - ^(') Would the function of the protein be restored? Choose the best answer. No, while the serine is present, it is not in the same location as the original protein. Even though the rest of the protein is functional, shifting the amino acid a few positions would likely not allow it to be phosphorylated. Yes, now the serine can be phosphorylated. No, while the serine is present in the protein, the rest of the mRNA is still out of frame. Yes, the reading frame has been restored and now the serine can be phosphorylated.

View Answer

BEST MATCH

Problem 2 A ball is thrown into the air from a ground, and its height, y (in feet), above the ground t seconds after it is thrown is given by $y = f(t) = -3t^2 + 24t + 15$ (Hint: use shortcut method to find derivatives and analyze your answers) (a) Determine the maximum height the ball reaches. What is the velocity at the time the ball is at the peak. (b) What is the average velocity of the ball at $t = 2$ seconds? (c) Use the graph to decide at what time, t, the ball reaches its maximum height.

View Answer

BEST MATCH

What are social movements?O Social movements are organizations that are tasked with vetting the qualifications of judicial nominees and oversee the processes of the Senate Judiciary Committee.O Social movements are government actions taken to uphold its obligation to protect individuals.O Social movements are sustained campaigns brought bydisadvantaged populations in support of a political or social goal.O Social movements are groups that focus only on providing mo campaigns.

View Answer

BEST MATCH

have both Exocrine (secretes digestive juice into the small intestine) and Endocrine units.– ( e.g. pancreas)= (secretes insulin and glucagon hormones into the blood), (enzymes into the duodenum)

View Answer

BEST MATCH

For children with two myopic parents, the likelihood of becoming myopic is ____ correlated with the number of hours spent playing sports each week. negatively perfectly positively not

View Answer

BEST MATCH

Solve for n algebraically. Show your work. frac{(n-5)!}{(n-7)!} = 110

View Answer

BEST MATCH

Rank your 3 metals (weakest to strongest reducing agent) based on your experimental results with a brief explanation. Mg Pb Zn

View Answer

BEST MATCH

The graph below depicts an economy where a decline in aggregate demand has caused a recession. This economy's current level of real GDP (Y) is below its long-run equilibrium, which is a. Without any fiscal policy, we expect the economy to eventually return to full employment on its own. Use the graph below to illustrate that process. Instructions: Use the tool provided 'New Curve' to plot the appropriate line (2 points total). After placing the curve, double click or tap the question marks next to it and choose whether to label the curve as AS1, LRAS1, or AD from the dropdown. self-Correction New Curve LRAS AS P. AD AD, Real GDP b. Assume the government instead enacts (Click to select) fiscal policy to reduce the burden of the recession. Use the graph below to illustrate that process. (Click to select Instructions: Use the tool provided 'New expansionary appropriate line (2 points total). After placing the curve, double click or tap the question marks next to it and choose whether to label the curve as AS, LRAS1, or AD2 from the dropdown. contractionary economic stabilizing Fiscal Policy New Curve LRAS AS Price Level AD,

View Answer

BEST MATCH

Q6 (10 points): Show/prove that the following language L is context-free L = \{0$^n$1$^n$: n $\ge$ 0, n is not a multiple of 5\}

View Answer

BEST MATCH

Aidlupvec -1 Bmtslu Mthe seps Let A = 0 1 0 Thus m = 3, n = 2. Its SVD is 0 2/6 1/3 1 -1/1 Typically, the singular values are arranged in decreasing order.

View Answer

virginia r.