Texts: #1-4 are restriction enzymes and the DNA sequence that they recognize. Which one of the enzymes below could cut the following DNA sequence? Assume the sequence is in a larger piece of DNA. 5' TCGATGAAGCTTG 3' 1.) AatII GACGTC 2.) BamHI GGATC 3.) EcoRI GAATTC 4.) HindIII AAGCTT 5.) XhoI CTCGAG
Added by John W.
Step 1
Step 1: Identify the DNA sequence given: 5' TCGATGAAGCTTG 3' Show more…
Show all steps
Your feedback will help us improve your experience
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Restriction enzymes are endonucleases produced by bacteria. These restriction enzymes: a) Typically recognise specific 4 to 8 bp sequences called restriction sites b) Cleave both strands of DNA at their specific restriction sites c) Ligate cut DNA by re-establishing phosphodiester linkages d) a, b and c above e) a and b above f) None of the above
Madhur L.
Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI: BamHI cleaves after the first G. 5’ G|GATCC 3’ 3’ CCTAG|G 5’ BclI cleaves after the first T. 5’ T|GATCA 3’ 3’ ACTAG|T 5’ You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i. If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments. ii. If the DNA shown above was cut with BclI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments. iii. You can ligate the smaller restriction fragment produced in (i) to the smaller restriction fragment produced in (ii). Write out the sequence of the resulting recombinant fragment. iv. Could you cut the fragment from (iii) with either BamHI or BclI? Explain.
Jenny W.
Which enzyme has the ability to cut DNA at specific regions? a. DNA ligase b. helicase c. DNA polymerase d. restriction enzymes
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD