Restriction enzymes are extensively used in molecular...

Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI: BamHI cleaves after the first G. 5’ G|GATCC 3’ 3’ CCTAG|G 5’ BclI cleaves after the first T. 5’ T|GATCA 3’ 3’ ACTAG|T 5’ You are given the DNA shown below. 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ i. If this DNA was cut with BamHI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments. ii. If the DNA shown above was cut with BclI, how many DNA fragments would you expect? Write out the sequence of these double-stranded DNA fragments. iii. You can ligate the smaller restriction fragment produced in (i) to the smaller restriction fragment produced in (ii). Write out the sequence of the resulting recombinant fragment. iv. Could you cut the fragment from (iii) with either BamHI or BclI? Explain.

Transcript

00:01 So you're giving a double -stranded dna sequence, and the dna will be cut by two restriction enzymes.

00:07 One is babbage 1 and b -c -l, the other is b -c -l -1.

00:11 So the restriction enzyme will recognize a specific site in dna and cut between the nucleotides.

00:18 So bavitur 1 recognized from 5 to 3 g -g -a -t -c -c and cut between the first two nucleotide g.

00:28 Bcl recognized from 5 to 3 tg a tc8 and cut between the first t and second g.

00:35 So the first question says if dna is cut by bamh1, how many dna fragments would you expect? and write out the sequence of double -stranded dna fragment.

00:45 So you can see, i use the black color to copy down the entire sequence, and i use red color to represent the bamh1 sequence.

00:53 And then so i show where the enzyme is going to recognize the dna.

01:00 So you can see the bamh1 site will recognize the bavich 1 enzyme will recognize the site gga tccc, which is on the 6 nucleotide from the left side of the dna sequence.

01:15 So there is only one bamh1 site, so it cut the dna once and produced two fragments.

01:21 So the enzyme is going to cut between the first two nucleotide g on top and bottom stretch.

01:33 So after cutting the one dna separate into two dna fragment.

01:38 So as you can see, i use red color to show you the two fragments.

01:43 The shorter fragments start from top strand 5 to 3 from left to right direction.

01:49 So the first six nucleotide, g -a -t -g, all the way to the cutting site.

01:57 And the bottom one is the complementary strength.

01:59 However, the complementary strength has four additional nucleotides.

02:04 If you read from 5 to 3, it's g -a -t -c.

02:08 So this is the overhead, or we call it a sticky end, produced by the cutting of the bammachuan enzyme.

02:15 And so the rest of the sequence will be the longest, fragment of the bamatur 1 cutting.

02:22 So you can see i copy all the sequence down.

02:26 So it's from the first g all the way to the last g on the 3 prime end.

02:33 So this is the rest of the sequence of 5 to 3, and the bottom one is the complementary strand of the top strand.

02:40 Again, this longer sequence also has a sticky end from 5 to 3 gatc.

02:49 So this is bamich 1.

02:50 The second question repeated, it says that if you cut this enzyme, the dna with another enzyme, bcl1, how many fragments would you expect? and what would be the sequence? so i use green color to represent the bcl1 site...

Question

Please give Ace some feedback