1. Most of the RNA in a cell is mRNA. mRNA is used to make: ____ 2. When more copies of the purple pigment gene were added, the resulting petunias were: ___ 3. A mutation that does not change the structure of the resulting protein is called a _____mutation. 4. The start codon is_____ 5. During transcription, the DNA template strand is read starting at the _________ end 6. Explain what would happen if a mutation resulted in the addition of a single nucleotide after the start codon in the above sequence. What is this kind of mutation called and how would it affect the structure of the encoded protein?
Added by Brian M.
Step 1
Step 1: mRNA is used to make proteins by working with the DNA template strand, getting information from the DNA, and specifying the amino acid sequence for protein production. Show more…
Show all steps
Your feedback will help us improve your experience
Jakob Waidelich and 61 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
1. The template strand of a gene includes this sequence: 3' TACTTGGATATC 5' a. Write the resulting mRNA strand after transcription: b. Write the resulting amino acid sequence: 2. The initial template strand is mutated to: 3' TACTTGAATATC 5' a. Write the resulting mRNA strand after transcription: b. Write the resulting amino acid sequence: 3. What is the effect of the mutation on the amino acid sequence?
Sarah C.
The following gene sequence appears on one strand of a segment of DNA that is about to go through DNA Replication. What code will DNA Polymerase build to make the complementary strand? TACGGCATATGCAAATGGCGAGCCTATATT
Madhur L.
In transcription, where are new nucleotides always added onto the growing RNA chain? Group of answer choices: a) 3' phosphate b) 5' phosphate c) 3' OH d) 5' OH e) nitrogenous base What would be the consequences of a two nucleotide-deletion mutation in the middle of the first intron of a protein-coding gene? a) The result would be no change in the protein, since deletions are very rare. b) A reading frameshift would occur. All codons (and thus amino acids) downstream of the codon in which the deletion occurred would be different, including the stop signal. c) Some codons might be altered since there are changes in the bases of the DNA, but the stop codon would remain the same and the protein would still be made. d) Since introns are not coding regions, no changes in the protein would occur. e) No change in the reading frame would occur due to the degeneracy of the genetic code. If the sequence of an RNA molecule is 3'-GGCAUCGACG-5', what is the sequence of the template strand of DNA? Group of answer choices: 5'-GGCATCGACG-3' 3'-GGCATCGACG-5' 5'-CCGTAGCTGC-3' 3'-CCGTAGCTGC-5' 3'-CGTCGATGCC-5'
Keemin L.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
200,000+
Students learning Biology with Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD
