The following gene sequence appears on one strand of a segment of DNA that is about to go through DNA Replication. What code will DNA Polymerase build to make the complementary strand? TACGGCATATGCAAATGGCGAGCCTATATT
Added by Joan C.
Step 1
To make the complimentary strand, DNA Polymerase will build the sequence ATGCCGTATACGTTTACCGCTCGGATAATA. Show more…
Show all steps
Your feedback will help us improve your experience
Madhur L and 70 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Assignment 5: DNA Replication, Transcription and Translation Problems -15 points 1. The following gene sequence appear on one strand of a segment of DNA that is about to go through DNA Replication. What code will DNA Polymerase build to make the complimentary strand? TACGGCATATGCAAATGGCGAGCCTATATT 2. The DNA sequence from Question #1 is being transcribed by RNA Polymerase into mRNA. What will be the resulting mRNA sequence? 3. The mRNA sequence from Question #2 is being translated into a polypeptide chain by ribosomes. What will be the amino acid sequence? 4. Unfortunately, the cells carrying the DNA code in Question #1 have been subjected to lots of ultraviolet radiation and the DNA has been damaged! A base deletion occurred, removing the sixth base, the C. What will be the resulting mRNA sequence that is transcribed? 5. What will be the new amino acid sequence translated from the resulting mRNA transcript in Question #4?
Josee P.
The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT 5’ 5’ ACTTCGTATAATCATGGCTACAGCTTCGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand (top/bottom) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don't forget that there is always some 5' untranslated region encoded in the mRNA. Give the N and C ends of the protein.
Adi S.
The following DNA strand is a template strand of a prokaryotic gene. Transcription start site is indicated by a bold "G". a) Underline the promoter region of this gene by a dotted line. b) Underscore the Pribnow box in the promoter region. What is the function of the Pribnow box? c) Deduce the nucleotide sequence of mRNA for this gene. d) Underscore the leader sequence in mRNA and box the initiation codon. How many amino acids does this mRNA code for? What is the sequence of the codons in this mRNA? e) Show 5' and 3' ends of the template strand and mRNA. f) What are the -10 and +10 base pairs of this gene? CCCTCCGTCGCTATAATGAAGTCGGAGACGGATGTACCGCGGATAA
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD