The given mRNA sequence is transcribed from the gene below it. 5’ AGCUUCGAACUCAUGCAGGGCCACCCGAUUACCAUGUAAGUUACGCA 3’ 3’ TGAAGCATATTAGTACCGATGTCGAAGCTTGAGTACGTCCCGGTGGGCTAATGGTACATTCAATGCGT 5’ 5’ ACTTCGTATAATCATGGCTACAGCTTCGAACTCATGCAGGGCCACCCGATTACCATGTAAGTTACGCA 3’ Within the double-stranded DNA above: a. Which strand (top/bottom) is the coding strand? b. Circle the -10 promoter element. c. Underline a single nucleotide indicating the transcription start site. d. Circle the translation start and stop codons. e. What is the amino acid sequence encoded by the mRNA given? Don't forget that there is always some 5' untranslated region encoded in the mRNA. Give the N and C ends of the protein.
Added by Pamela A.
Step 1
The coding strand is the one that has the same sequence as the mRNA (except for T instead of U). In this case, it is the top strand. b. The -10 promoter element is typically a TATA box, which is found around 10 nucleotides upstream of the transcription start Show more…
Show all steps
Your feedback will help us improve your experience
Adi S and 83 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
In order to answer the question, consider this mRNA sequence: 5'-GGUAGAUGUUGUCUUCGCAUACAGAUUGAGCGAAAA-3'. a. Underline the start and stop codons (the start codon, AUG, defines the reading frame). b. Indicate where you would find the 5' cap. c. Put a box around the 5'-untranslated region (5'-UTR). d. Put a box around the 3'-untranslated sequence (3'-UTR). Indicate where the poly-A tail would be. e. List in order of usage the anticodons of the tRNAs that will be used to translate this message. f. What is the amino acid sequence of the protein encoded by this message? g. What was the double-stranded DNA that resulted in this mRNA? Which strand is the "coding" strand, and which is the "template" strand? (Don't forget to label the 5' and 3' ends of the DNA). Coding strand: Template:
Adi S.
Sri K.
1. What is the resulting amino acid sequence from translating the following mRNA molecule: 5' - AUG GCC CCC UAG - 3'? 2. What is the resulting mRNA sequence from transcribing the following template strand of DNA: 3'-TAC CGT GGG ATC - 5'? What is the resulting amino acid sequence from the mRNA strand you just transcribed? 3. In comparing the mRNA sequences from questions 1 and 2, is there a mutation present? Was the resulting amino acid sequence between questions 1 and 2 different?
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD