1. What is the resulting amino acid sequence from translating the following mRNA molecule: 5' - AUG GCC CCC UAG - 3'? 2. What is the resulting mRNA sequence from transcribing the following template strand of DNA: 3'-TAC CGT GGG ATC - 5'? What is the resulting amino acid sequence from the mRNA strand you just transcribed? 3. In comparing the mRNA sequences from questions 1 and 2, is there a mutation present? Was the resulting amino acid sequence between questions 1 and 2 different?
Added by Joseph R.
Close
Step 1
Step 1: Translate the mRNA sequence 5' AUG GCC CCC UAG 3' to amino acids using the genetic code. Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 58 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Transcribe this segment of DNA (give the mRNA sequence) and then translate the mRNA (give the amino acid sequence of the polypeptide that will be produced). (How does a ribosome know where to start translating?) 3' CCGATACAGCCTAAACACTT 5' template strand 5' GGCTATGTCGGATTTGTGAA 3' coding strand mRNA: 5' amino acid sequence: b. Now change the bold nucleotides so that the A becomes a G and the T becomes a C. What kind of a mutation is this? i. frameshift ii. nonsense iii. missense iv. silent
Bryan V.
The following DNA sequence occurs in the nontemplate strand of a structural gene in a bacterium (the promoter sequence is located to the left but is not shown): $l$ $5^{\prime}-$ GAATGTCAGAACTGCCATGCTTCATATGAATAGACCTCTAG-3" (a) What is the ribonucleotide sequence of the mRNA molecule that is transcribed from this piece of DNA? (b) What is the amino acid sequence of the polypeptide encoded by this mRNA? (c) If the nucleotide indicated by the arrow undergoes a mutation that changes $T$ to $A$, what will be the resulting amino acid sequence following transcription and translation?
Consider the following segment of mRNA produced by the nomal order of DNA nucleotides: CUU AAA CGA CAU a. What is the amino acid order produced from this mRNA? b. What is the amino acid order if a point mutation changes CUU to CCU? c. What is the amino acid order if a point mutation changes CGA to AGA? d. What happens to protein synthesis if a point mutation changes AAA to UAA? e. What is the amino acid order if an insertion mutation adds a G to the beginning of the mRNA segment? f. What is the amino acid order if a deletion mutation removes the $\mathrm {C}$ at the beginning of the mRNA segment?
Nucleic Acids and Protein Synthesis
Genetic Mutations
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD