A. Transcribe this segment of DNA (give the mRNA sequence)...

a. Transcribe this segment of DNA (give the mRNA sequence) and then translate the mRNA (give the amino acid sequence of the polypeptide that will be produced). (How does a ribosome know where to start translating?) 3' CCGATACAGCCTAAACACTT 5' template strand 5' GGCTATGTCGGATTTGTGAA 3' coding strand mRNA: 5' _________________________________________________________________ 3' amino acid sequence: _________________________________________________________________ b. Now change the bold nucleotides so that the A becomes a G and the T becomes a C. What kind of a mutation is this? i. frameshift ii. nonsense iii. missense iv. silent

Transcript

00:01 In order to answer this question, let's talk about transcription and also translation.

00:04 It says, transcribe this segment of dna, give the messenger rna sequence, and then translate the messenger rna give the medium minus sequence of the polypeptate that will be produced.

00:17 How does that go away from nowhere to start translating? so first is that transcription.

00:24 Remember that you have two strands of dna.

00:27 You have that template strand that goes from 3 to 5, and you have that coding strand that goes from 5 to 3.

00:32 Also, you have your messenger rna.

00:34 Let's graph the representative here, okay? you have the coding strand.

00:38 You have the template in the coding strand.

00:40 You remember that the template in the coding strand are complementary to each other, following base pairing rules, okay? so when you produce your messenger rna, this messenger rna is going to be complementary to the template to.

00:53 So the coding strand in the messenger rna, both are complementary to a template.

00:57 So it means that both the coding strength in the messenger rna are going to have the same nucleotype sequence.

01:05 With the only difference that a coding strand, as it is dna, it is going to have thymein while messenger rna as it is rna.

01:12 It is going to have euras.

01:14 So you have here your template strand.

01:16 Here you have your coding strand.

01:17 You can use based print rules to create your messenger rna.

01:20 But practically, as i told you, it is going to have the same sequence as the coding strand.

01:25 We just have to change the thymines by eurasils.

01:30 So let's write here.

01:31 Or let me write it with my hand here.

01:36 You want to have g g, g, c, u -a -u -g -g -u -c -g -a -u -c -g -a -u -c -g -a -u -c -g -a -u -g -a.

01:53 Okay, so this is going to be your messenger rna...

Question

Please give Ace some feedback