2. The Genetic Code on the mRNA is "read" in the 5' to 3' direction in sets of 3 bases at a time. These sets are referred to as codons or triplets. Assume the template strand of the above transcription unit is: +1 3' TGCATGCACCGGAATACGTAGATTCACGG 5' A. On top of the DNA written above, write out the other strand of DNA. Put in the proper polarity (the 5' and 3' ends.) B. You are told that the RNA polymerase binds the DNA and moves TO THE RIGHT, starting to transcribe at the start site (or +1), so label the template and coding strands. C. In the area below the DNA, PROPERLY, transcribe this piece DNA into mRNA. Label the 5' and 3' ends.
Added by Nicole F.
Close
Step 1
The complementary bases are as follows: T -> A G -> C C -> G A -> T So, the other strand of DNA is: 5' ACGTACGTGGCCTTATGCATCTAAGTGCC 3' B. Since the RNA polymerase moves to the right, the template strand is the one that the RNA polymerase binds to and Show more…
Show all steps
Your feedback will help us improve your experience
Sri K and 74 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Below is a DNA molecule. Transcribe this molecule into RNA and then translate the RNA into an amino acid sequence using the genetic code written in RNA nucleotides provided below. Hint: make sure to begin translation from the start codon. a. Which strand of DNA (coding, non-coding) will you use to transcribe the mRNA? Coding Strand 5 TGACATGGGTACACATGACGGG 3 Non-Coding (Template) Strand 3 ACTGTACCCATGTGTACTGCCC 5 b. What is the mRNA sequence that would be transcribed from this DNA sequence? What is the protein sequence (amino acids) that will be translated from this mRNA molecule? Remember to look for the start codon.
Maitreya E.
1) Each DNA molecule has two sides, one is called the template from which the mRNA is constructed by RNA polymerase, and the other is the coding side which codes for a protein. If the template side of a DNA molecule is the sequence shown below, what will the coding side base sequence be? coding Template T A C T T C C T A T T T T C T T G T C A C C G C A C T 2) If the template strand from above is used, what will the resulting mRNA molecule base sequence be? Write the base sequence for mRNA above the bases of the DNA molecule. mRNA Template T A C T T C C T A T T T T C T T G T C A C C G C A C T 3) Using the codon chart in your notes, determine the amino acid sequence for the mRNA sequence above. 4) If a mutation occurred to the fourth base in the template side, and a substitution occurred such that the thymine was replaced by a guanine, would the protein be changed? If so, how?
Dennis H.
PART 3: Translating mRNA to protein After RNA processing, the mature mRNA is exported from the nucleus to the cytoplasm. At this point the mature mRNA can be translated based on its reading frame and the genetic code. The position of the start codon defines the reading frame of the mature mRNA. Identify and underline the start codon in the mRNA sequence that you wrote out in Box II. *Hint: In the gene Q mRNA the start codon is located closest to the 5’ end of the mature mRNA. Once the reading frame start is located, the rest of the codons can be identified by organizing the nucleotides into contiguous sets of three at a time. The end of the reading frame is defined by the presence of one of the three possible stop codons in the same frame.
Suman K.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD