1. The diagram shows an early stage of elongation in E coli (which will proceed from left to right). The questions that follow relate to the numbered parts of the figure. AA1 AA2 NNN UAU NNN AUA AAC ACG UAU UAG a. Does the small subunit bind to the mRNA before or after the large subunit? b. Is circled label "2" the 5' end or the 3' end of the mRNA (the ribosome is moving from left to right)? c. Label "3" is the start codon, what are these three bases? Be sure to indicate the 5' and 3' end. d. What amino acid is indicated by label "4" and is attached to the tRNA that is interacting with the start codon? e. What amino acid is label 6 pointing to? f. Label "7" is a codon, and it will be bound by , which are proteins that help release the growing polypeptide chain and dissociate the ribosome from the mRNA. g. The mRNA shown will encode a polypeptide that is amino acids long. What is the string of polypeptides encoded by this mRNA?
Added by Sean G.
Close
Step 1
** Show more…
Show all steps
Your feedback will help us improve your experience
Jackson Miner and 60 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
Refer to the figure to answer these questions: a. Add labels for mRNA (including the $5^{\prime}$ and $3^{\prime}$ ends) and tRNA. In addition, draw in the RNA polymerase enzyme and the ribosomes, including arrows indicating the direction of movement for each. b. What are the next three amino acids to be added to polypeptide $b$ ? c. Fill in the nucleotides in the mRNA complementary to the template DNA strand. d. What is the sequence of the DNA complementary to the template strand (as much as can be determined from the figure)? e. Does this figure show the entire polypeptide that this gene encodes? How can you tell? f. What might happen to polypeptide $b$ after its release from the ribosome? g. Does this figure depict a prokaryotic or a eukaryotic cell? How can you tell?
Use the following mRNA sequence to answer the questions that follow: Use the genetic code in the lecture PowerPoints or your textbook: 5' - AGAUCACAGAGGGACGAUUCUCACUCUCUCUU The above mRNA sequence is in the process of being translated by ribosome. The tRNA located in the P site has the anticodon sequence: 5'-CUC-3'. Define the reading frame by adding a SPACE between each of the codons in the mRNA. b) As mentioned above, the tRNA located in the P site has the anticodon sequence: 5'-CUC-3'. What amino acid is specified by the codon in the P site? c) What codon is in the A site at this time? d) What codon is in the E site at this time? After forming a peptide bond to the amino acid specified by the codon in part "(c)", the ribosome translocates [recall: this means the ribosome moves forwards one codon]. Now, while the ribosome is in this position, what amino acid will be added to the growing polypeptide chain?
Shaiju T.
$\begin{array}{|c|c|}\hline \text { Codon on mRNA } & {\text { Amino Acid }} \\ \hline \mathbf{G C A} & {\text { alanine }} \\ \hline \mathbf{A A G} & {\text { lysine }} \\ \hline \mathbf{G U U} & {\text { valine }} \\ \text { AAU } & {\text { asparagine }} \\ \hline \mathbf{U G C} & {\text { cysteine }} \\ \hline \mathbf{U C G} & {\text { serine }} \\ \hline \mathbf{U C U} & {\text { serine }} \\ \hline \text { UUA } & {\text { leucine }} \\ \hline \text { UAA } & {\text { stop }} \\ \hline\end{array}$ You are given three mRNA sequences: 1. 5’-UCG-GCA- AAU-UUA -GUU-3’ 2. 5’-UCU-GCA- AAU-UUA -GUU-3’ 3. 5’-UCU-GCA- AAU-UAA -GUU-3’ Using the peptide encoded by each of the above, compare the three peptides obtained. How are peptides 2 and 3 different from 1? What would be the consequence for the cell in each case? a. There is a silent mutation in peptide 2 and peptide 3 has a stop codon due to mutation. b. There is a silent mutation in peptide 3 and peptide 2 has a stop codon due to mutation. c. There is a different amino acid in peptide 2 and peptide 3 has a stop codon due to mutation. d. There isn’t a mutation in peptide 2 and peptide 3 has a stop codon due to mutation.
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
18,000,000+
Students on Numerade
Trusted by students at 8,000+ universities
Watch the video solution with this free unlock.
EMAIL
PASSWORD