Use the following mRNA sequence to answer the questions that follow: Use the genetic code in the lecture PowerPoints or your textbook:
5' - AGAUCACAGAGGGACGAUUCUCACUCUCUCUU
The above mRNA sequence is in the process of being translated by ribosome. The tRNA located in the P site has the anticodon sequence: 5'-CUC-3'. Define the reading frame by adding a SPACE between each of the codons in the mRNA.
b) As mentioned above, the tRNA located in the P site has the anticodon sequence: 5'-CUC-3'. What amino acid is specified by the codon in the P site?
c) What codon is in the A site at this time?
d) What codon is in the E site at this time?
After forming a peptide bond to the amino acid specified by the codon in part "(c)", the ribosome translocates [recall: this means the ribosome moves forwards one codon]. Now, while the ribosome is in this position, what amino acid will be added to the growing polypeptide chain?