Question

1. Consider the following DNA molecule 5’ CCGGGGCCAATTGGCCGTACCGAATTGGCCGAATTCCGGCCTTGGCCTACGGGCTCGGGCCGC 3’ 3’ GGCCCCGGTTAACCGGCATGGCTTAACCGGCTTAAGGCCGGAACCGGATGCCCGAGCCCGGCG 5’ How many base pairs (bp) is the original fragment? (1 point) _ The enzyme HaeIII has the following restriction site 5’ GGvCC 3’ 3’ CC^GG 5’ (‘v’ and ‘^’ indicates the specific bond that is digested) If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) _ If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point) ___ 2. Using the results from question #1 (for entire sequence and linear DNA), draw the results on a gel( ‘—’ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

          1. Consider the following DNA molecule
5’ CCGGGGCCAATTGGCCGTACCGAATTGGCCGAATTCCGGCCTTGGCCTACGGGCTCGGGCCGC 3’
3’ GGCCCCGGTTAACCGGCATGGCTTAACCGGCTTAAGGCCGGAACCGGATGCCCGAGCCCGGCG 5’

How many base pairs (bp) is the original fragment? (1 point) ___

The enzyme HaeIII has the following restriction site 5’ GGvCC 3’
3’ CC^GG 5’
(‘v’ and ‘^’ indicates the specific bond that is digested)

If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point) ___

If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point) ___

2. Using the results from question #1 (for entire sequence and linear DNA), draw the results on a gel( ‘—’ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

1. Consider the following DNA molecule
5’ CCGGGGCCAATTGGCCGTACCGAATTGGCCGAATTCCGGCCTTGGCCTACGGGCTCGGGCCGC 3’
3’ GGCCCCGGTTAACCGGCATGGCTTAACCGGCTTAAGGCCGGAACCGGATGCCCGAGCCCGGCG 5’

How many base pairs (bp) is the original fragment? (1 point)

The enzyme HaeIII has the following restriction site 5’ GGvCC 3’
3’ CC^GG 5’
(‘v’ and ‘^’ indicates the specific bond that is digested)

If digested with HaeIII, how many fragments are formed if the DNA is linear? (1 point)

If digested with HaeIII, how many fragments are formed if the DNA is circular? (1 point)

2. Using the results from question #1 (for entire sequence and linear DNA), draw the results on a gel( ‘—’ = the well). Well A contains the complete, intact, undigested sample/sequence; well B contains digested sample/sequence. (4 points)

Added by Ashley W.

Question

Please give Ace some feedback