17. The genetic material found within some viruses is single-stranded DNA. Would this genetic material contain equal amounts of A and T and equal amounts of G and C? The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single- stranded RNA or double-stranded RNA? (hint: you should justify the answer to the viral part of this question using chi-square)
Added by Bobby M.
Close
Step 1
This is due to the base pairing rules (A with T, and G with C). In single-stranded DNA, there is no such constraint, so the amounts of A, T, G, and C can vary independently. Show more…
Show all steps
Your feedback will help us improve your experience
Dominador Tan and 61 other Biology educators are ready to help you.
Ask a new question
Labs
Want to see this concept in action?
Explore this concept interactively to see how it behaves as you change inputs.
Key Concepts
Recommended Videos
The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded RNA? Calculate the A, C, G, and T content for the following molecule, which is part of a gene from a plant chloroplast. Only one of the two strands is shown: 5'-tcattcatgattggccaaatcattgatacaaataatatccaaataccaaatccgccttctagataaccttcgcgaaatagaagaaactcttggaaaggtcaaggaaaaaacttgttcttctt-3' Assume instead that the sequence was for a virus with a genome consisting of single-stranded DNA. How would this change your calculation?
Dominador T.
The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded RNA?
Bryan V.
The relative amounts of each nudeotide base are tabulated here for four different viruses. For each virus listed in the following table, indicate whether its genetic material is DNA or RNA and whether it is single stranded or double stranded. Explain your reasoning. $$\begin{array}{cccccc} \text { Virus } & \mathbf{T} & \mathbf{C} & \mathbf{U} & \mathbf{G} & \mathbf{A} \\ \mathbf{I} & 0 & 12 & 9 & 12 & 9 \\ \text { II } & 23 & 16 & 0 & 16 & 23 \\ \text { III } & 34 & 42 & 0 & 18 & 39 \\ \text { IV } & 0 & 24 & 35 & 27 & 17 \end{array}$$
Recommended Textbooks
Biology for AP Courses
Objective Biology for NEET
Introduction to General, Organic and Biochemistry
Transcript
Watch the video solution with this free unlock.
EMAIL
PASSWORD